We narrowed to 1,731 results for: plasmids pcas
-
Plasmid#197500PurposeCMV and T7 promoter expression plasmid for human codon optimized ABE(8.20) A-to-G base editor with nSpCas9-NRTH(D10A) and P2A-EGFPDepositorInsertpCMV-T7-BPNLS-ABE8.20m-nSpCas9-NRTH-BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.20 mutations in TadA and nSpCas9-NRTH(D10A/I…PromoterCMV and T7Available SinceMarch 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g1_CASH-1
Plasmid#188975PurposeA human codon-optimized SpCas9 nickase and chimeric g1 guide RNA expression plasmid.DepositorInsertg1 guide RNA
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX335-U6-Chimeric_BB-CBh-hSpCas9n(D10A)_g2_CASH-1
Plasmid#188976PurposeA human codon-optimized SpCas9 nickase and chimeric g2 guide RNA expression plasmid.DepositorInsertg2 guide RNA
ExpressionMammalianAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-SpCas9-NG-P2A-EGFP (RTW3677)
Plasmid#139994PurposeCMV and T7 promoter expression plasmid for human codon optimized SpCas9-NG(L1111R/D1135V/G1218R/E1219F/A1322R/R1335V/T1337R) with a c-terminal bi-partite NLS, 3x flag tag, and P2A-EGFPDepositorInserthuman codon optimized SpCas9-NG with BPNLS-3xFLAG-P2A-EGFP
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationSpCas9-NG=L1111R/D1135V/G1218R/E1219F/A1322R/R133…PromoterCMV and T7Available SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pACYC-T7-SpCas9-T7-EGFP_gRNA1-T7term (BPK848)
Plasmid#181745Purposedual T7 promoter vector for bacterial expression of SpCas9 with a c-terminal NLS and 3xFLAG tag, along with an SpCas9 sgRNA targeting EGFP site 1DepositorInserthuman/zebrafish codon optimized SpCas9
UseIn vitro transcription; t7 promoterTagsNLS(SV40)-3xFLAGExpressionBacterialPromoterT7Available SinceFeb. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA1 (PX459)
Plasmid#221551PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceSept. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCAS9 wt (BB)-2A-GFP targeting human TRIM21
Plasmid#138295PurposegRNA for CRISPR/Cas9 knockout of human TRIM21DepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA528 IST1 L328D, L355A (1-366)
Plasmid#193040PurposeBacterial expression plasmid for full-length IST1 (1-366) with L328D and L355A mutations that diminish binding to MIT domains.DepositorAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG CAPN7 V18D,F98D-OSF
Plasmid#193045PurposeMammalian expression plasmid encoding full-length CAPN7 with V18D and F98D mutations that diminishes binding to IST1. Contains C-terminal OSF tag (One-Strep-FLAG)DepositorInsertCAPN7 (CAPN7 Human)
TagsOSF (One-Strep-FLAG)ExpressionMammalianMutationV18D, F98DPromoterChicken Beta-actinAvailable SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCA528 CAPN7 V18D,F98D (1-165)
Plasmid#193034PurposeBacterial expression plasmid for CAPN7 (1-165) tandem MIT domains with V18D and F98D mutations that abolish binding to IST1.DepositorInsertCAPN7 (CAPN7 Human)
Tags6xHis-SumoExpressionBacterialMutationV18D, F98D, Residues 1-165PromoterT7Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9-2A-Puro-RAB7A-gRNA2 (PX459)
Plasmid#221552PurposeExpresses Cas9 and gRNA for disruption of Rab7A gene in human cellsDepositorAvailable SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-3exo-Tetra-com-CLCN5-sp-g1
Plasmid#176236PurposePlasmid for expressing a fusion protein of spCas9 and the 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-5Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176237PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pspCas9-Exo-tetra-com-hCLCN5-sp-g1
Plasmid#176238PurposePlasmid for expressing a fusion protein of spCas9 and the 5’ and 3’ exonuclease domain of POLI, and sgRNA targeting human CLCN5 gene.DepositorInsertspCas9 and polymerase exo domain fusion (CLCN5 Human)
ExpressionBacterialAvailable SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-TadCBEd-SpCas9(LWKYQS)-P2A-EGFP (BKS1014)
Plasmid#223127PurposepCMV and pT7 Human expression plasmid for TadCBEd using SpCas9 CBE enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA-CDd-SpCas9(LWKYQS)-2xUGI-P2A-EGFP
UseCRISPRTags2xUGI-BPNLS-P2A-EGFP and BPNLS-TadA-CDdExpressionMammalianMutationTadA-CDd mutations; nSpCas9(D10A/LWKYQS)=D1135L, …PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(LWKYQS)-P2A-EGFP (AHK404)
Plasmid#223113PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with LWKYQS amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(LWKYQS)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/LWKYQS)=D1135L, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(LWRYEK)-P2A-EGFP (BKS1028)
Plasmid#223114PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with LWRYEK amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(LWRYEK)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/LWRYEK)=D1135L, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-ABE8e-SpCas9(MKRCMV)-P2A-EGFP (BKS1030)
Plasmid#223115PurposepCMV and pT7 Human expression plasmid for ABE8e using SpCas9 enzyme with MKRCMV amino acids at positions 1135,1136,1218,1219,1335,T1337 with C-term BPNLS-P2A-EGFPDepositorInserthuman codon optimized TadA8e-SpCas9(MKRCMV)-P2A-EGFP
UseCRISPRTagsBPNLS-P2A-EGFP and BPNLS-TadA8eExpressionMammalianMutationTadA8e mutations; nSpCas9(D10A/MKRCMV)=D1135M, S1…PromoterCMV and T7Available SinceApril 23, 2025AvailabilityAcademic Institutions and Nonprofits only