We narrowed to 1,224 results for: gcat
-
Plasmid#149425PurposeThe attB plasmid with the mini-white harboring two U6.3-gRNAs targeting Dmel tra and bTub genes.DepositorInsertU6.3-gRNAs[TraB, bTub]
UseCRISPRExpressionInsectPromoterU6.3Available SinceMarch 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G3_MTOR_Nick_Intron-45_Dual_sgRNA
Plasmid#178099PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G3 and MTOR Nick intron-45 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G3 + MTOR nick intron-45 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
ATP1A1_G8_MTOR_Nick_Exon-44_Dual_sgRNA
Plasmid#178105PurposeControl vector for coselection for PE3 in human cells. Tandem expression of ATP1A1 G8 and MTOR Nick exon-44 sgRNAs from two independent U6 promoters.DepositorInsertATP1A1 G8 + MTOR nick exon-44 sgRNAs
UseCRISPR; Prime editingExpressionMammalianPromoterTandem U6 promotersAvailable SinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits only -
Bmpr2 gRNA#1
Plasmid#163388PurposeCas9-mediated knockout of Bmpr2 in mammalian cellsDepositorAvailable SinceAug. 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pZNF215.1.0-gDNA
Plasmid#113771PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ZNF215DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN190
Plasmid#91577PurposeExpress sgRNA targeting human BRINP2DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLRK36
Plasmid#253105PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting NAC21/22 genes in wheatDepositorInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available SinceMay 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLRK57
Plasmid#253106PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting DWF4 genes in wheatDepositorInsertSpCas9-P2A-RUBY
UseCRISPR and Synthetic BiologyExpressionPlantPromoterZmUbi1Available SinceMay 13, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgHK2_14
Plasmid#239257Purposelentiviral vector expressing Cas9 and an sgRNA targeting HK2DepositorInsertsgRNA_14 targeting HK2 (HK2 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2026AvailabilityAcademic Institutions and Nonprofits only -
pdTCas9_scr
Plasmid#207568PurposedThermoCas9-mediated silencing of genomic gene in E. coliDepositorInsertPlac/tet_dThermoCas9_PlacI_lacI_PJ23119_sgRNA(scrambled non-targeting spacer)
ExpressionBacterialMutationThermoCas9(D8A,H582A)Available SinceDec. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pX459-Fzd7 gRNA
Plasmid#246566PurposeCRISPR vector co-expressing Cas9 and a mouse Fzd7 gRNADepositorAvailable SinceDec. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Pdha1 Donor;3xV5 KO;Mff
Plasmid#240301PurposeKI:Pdha1 Donor:3xV5 KO:MFFDepositorInsertKI gRNA for Pdha1
UseAAVMutationNAAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Sptbn4 Donor;3xV5 KO;Nfasc
Plasmid#240296PurposeKI:Sptbn4 Donor:3xV5 KO:NfascDepositorInsertKI gRNA for Sptbn4
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQdCas12a.sggfp(B)
Plasmid#236040PurposeThe plasmid pQdCas12a.sggfp(B) expresses the dCas12a endonuclease and the sgRNA (design B) targeting the gfp gene.DepositorInsertquorum sensing cassette luxI, mutated luxR, and the LuxR-dependent promoter pLuxI , dCas12a and sgRNA design (B) of gfp gene
UseCRISPRPromoterquorum sensing promoterAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDL649
Plasmid#231164PurposeT-DNA encoding TRV2 with mobile gRNA targeting SlHAIRLESSDepositorInsertmobile gRNA targeting SlHAIRLESS
ExpressionPlantPromoterPEBV sub-genomicAvailable SinceMarch 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-ACTB-C4
Plasmid#229849PurposeExpresses wild-type Cas9 and gRNA for ACTB gene. The target sequence is changed from ACTB-C1 to improve the cut efficiency.DepositorInsertguide RNA for ACTB gene
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgMTHFD1
Plasmid#217436PurposeLentiviral vector expressing Cas9 and an sgRNA targeting human MTHFD1DepositorInsertsgRNA targeting MTHFD1 (MTHFD1 Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 31, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_3-As
Plasmid#209033PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and AsCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-CD46 Ex3_1-Lb
Plasmid#209027PurposeLentiviral vector expressing U6 driven hybrid guide (hgRNA) targeting human CD46 Exon 3 for deletion using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInserthgRNA for deletion of CD46 Exon 3 with SpCas9 tracrRNAv1 & LbCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only