We narrowed to 19,678 results for: cat
-
Plasmid#191026Purposegcy-18 fluorescent neural reporter driving nuclear mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable sinceNov. 3, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pEY48
Plasmid#191052Purposeklp-6 fluorescent neural reporter driving nuclear mNeptune2.5 and CyOFP1 expression (refer to NeuroPAL paper for expression)DepositorAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEY47
Plasmid#191051Purposegcy-21 fluorescent neural reporter driving nuclear CyOFP1 and mTagBFP2 expression (refer to NeuroPAL paper for expression)DepositorAvailable sinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIT6EG7ml
Plasmid#185886PurposeIn vivo gene amplification (HapAmp) of limonene synthetic module at RPL25 locus (14 copy).DepositorInsertsee comments
ExpressionYeastMutationERG20 F96W N127WAvailable sinceSept. 1, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
CROP_C9_Puro_ESR1
Plasmid#183288PurposeAll-in-One CRISPRko system with a guide RNA that targets ESR1 geneDepositorPublicationInsertESR1
UseLentiviralAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH2
Plasmid#183301PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH2 geneDepositorPublicationInsertIDH2
UseLentiviralAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBAD-BRIC
Plasmid#172343PurposeBioluminescent Red Indicator for Calcium (bacterial expression)DepositorInsertBRIC
ExpressionBacterialAvailable sinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJMP2836
Plasmid#160674PurposeMobile CRISPRi sfGFP 'test', gmc6 sgRNADepositorInsertgmc6 (gfp) sgRNA
ExpressionBacterialAvailable sinceOct. 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pIF251
Plasmid#133935PurposeKanamycin selection marker flanked by ~200 bp of homology to bacteriophage lambda. The selection marker will recombineer 21.3-22.8 kb away from the cosL DNA end of the phage genome.DepositorInsertKanamycin selection marker flanked by ~200 bp of homology to bacteriophage lambda
UseΛ-phage recombineering plasmidAvailable sinceMarch 3, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNP1 OR sfGFP
Plasmid#107364PurposeExpresses sfGFP (a GFP) in Ecoli off a T7 promoter when pNP1 OR input A and pNP1 OR input B are co-expressedDepositorInsertOR gate + sfGFP
ExpressionBacterialPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNP1 OR input A
Plasmid#107365PurposeInput A for pNP1 OR gate sfGFPDepositorInsertOR gate input A
ExpressionBacterialPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
pNP1 OR input B
Plasmid#107366PurposeInput B for pNP1 OR gate sfGFPDepositorInsertOR gate input B
ExpressionBacterialPromoterT7Available sinceJan. 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
hsp70:GalT-RFP
Plasmid#105966Purposeheat shock inducible transgenesis, Galactsyl transferase (trans-golgi marker)DepositorInsertGalT
TagsmRFP1ExpressionBacterialAvailable sinceFeb. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
BB1_O_34_AMA1_2.8
Plasmid#90293PurposeBB1 with AMA1_2.8 sequence for transient plasmid propagation in A. niger between FS 34DepositorInsertAMA1_2.8
ExpressionBacterialMutationit is a truncated version of AMA1 (5.3 kb)Available sinceJuly 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB2799
Plasmid#63658PurposepCfB2799 is a vector for multiple integrations at sites sharing homology with Ty3Cons. The selective marker is Kl.LEU2. Additionally it contains a PTEF1-GFP as reporter.DepositorInsertGFP
UseCre/LoxExpressionYeastPromoterTEF1 promoterAvailable sinceAug. 15, 2016AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMLS285
Plasmid#73734PurposeSapTrap egl-13 NLS connector donor plasmidDepositorInsertegl-13 NLS
UseCRISPRAvailable sinceMarch 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_HHEX_1
Plasmid#72354PurposeEncodes gRNA for 3' target of human HHEX along with Cas9 with 2A GFPDepositorInsertHHEX (HHEX Human)
UseCRISPRAvailable sinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_TP73
Plasmid#214691PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable sinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCN34e-ktrA-yfp
Plasmid#227640Purposec-di-AMP biosensor plasmid. Encodes yfp downstream of c-di-AMP-binding ktrA riboswitch. Plasmid confers ampicillin resistance to E. coli and erythromycin resistance to S. aureus.DepositorInsertktrA-yfp
ExpressionBacterialAvailable sinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only