We narrowed to 16,015 results for: grn
-
Plasmid#164043PurposeU6-driven sgRNA targeting H2BDepositorInsertH2B targeting sgRNA
UseCRISPRTagsExpressionMutationPromotermouse U6Available SinceJan. 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFH88
Plasmid#128201PurposesgRNA backbone for SaCas9, combine with TaU3 promoter module (pFH33)DepositorInsertsgRNA backbone for SaCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1.linker_KO
Plasmid#164688PurposeFor CRISPR knockout of miR-144~451 linker region by lentiviral delivery of Cas9 and linker gRNADepositorInsertmiR-144~451 linker CRISPR KO gRNA
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available SinceMarch 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDDIT3.1.0-gDNA
Plasmid#112396PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor DDIT3DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMH184
Plasmid#122857PurposeMS2-modified guide RNA targeting the FT promoter with GreenGate E-F flanking sequencesDepositorInsertMS2-modified sgRNA targeting the Arabidopsis FT promoter
UseGolden gate compatible cloning vectorTagsExpressionMutationPromoterAvailable SinceMarch 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCREB1.1.0-gDNA
Plasmid#113770PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CREB1DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCSDC2.1.0-gDNA
Plasmid#113781PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CSDC2DepositorAvailable SinceDec. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-hsg(M)
Plasmid#138262PurposeSubcloning and expression of mCherry-targeting sgRNA M for use in Traffic Light reporter systemDepositorInsertsgRNA M
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAEF6
Plasmid#136303PurposepAEF5 plasmid with two gRNA insertedDepositorInsertdouble cassette coding for gRNA
UseCRISPR; Template for pcr to insert double grna co…TagsExpressionMutationPromoterAvailable SinceFeb. 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH99
Plasmid#128204Purposeclassic sgRNA backbone for SpCas9, combine with AtU6-26 promoter module (pFH35)DepositorInsertclassic sgRNA backbone for SpCas9, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCLOCK.1.0-gDNA
Plasmid#112406PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor CLOCKDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFH100
Plasmid#128205Purposeimproved sgRNA backbone for SpCas9, combine with AtU6-26 promoter module (pFH35)DepositorInsertimproved sgRNA backbone for SpCas9, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH101
Plasmid#128206PurposesgRNA backbone for StCas9, combine with AtU6-26 promoter module (pFH35)DepositorInsertsgRNA backbone for StCas9, combine with AtU6-26 promoter module (pFH35)
UseCRISPR and Synthetic BiologyTagsExpressionPlantMutationPromoterAvailable SinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFOXO4.1.0-gDNA
Plasmid#112408PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor FOXO4DepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCCM937
Plasmid#58982PurposeExpresses avr-15 sgRNA in C.elegans.DepositorInsertavr-15 sgRNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available SinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCCM936
Plasmid#58981PurposeExpresses avr-14 sgRNA in C.elegans.DepositorInsertavr-14 sgRNA
UseCRISPRTagsExpressionWormMutationPromoterU6Available SinceJuly 30, 2014AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #2
Plasmid#202757PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TLCV2 - sgAP2S1 #1
Plasmid#202756PurposeEncodes Doxycycline inducible Cas9 and sgRNA targeting AP2S1DepositorInsertgRNA targeting AP2S1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Afp
Plasmid#99697PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Afp promoter, vector allows for activation of mouse Afp, can be packaged and delivered as AAVDepositorInsertdCas9 and gRNA targeting Afp (Afp Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable SinceNov. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only