We narrowed to 15,447 results for: grn
-
Plasmid#75240PurposeCRISPR/Cas9 plasmid against human IkarosDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
Ikaros-CRISPR #2 (PX458-EF1a-pSpCas9(BB)-2A-GFP)
Plasmid#75241PurposeCRISPR/Cas9 plasmid against human IkarosDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA against human Ikaros (IKZF1 Human)
UseCRISPRAvailable sinceJune 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-SaCas9-U6-sgGrin2b
Plasmid#124851PurposeMutagenesis of Grin2bDepositorInsertGrin2b (Grin2b Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable sinceMay 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLM-AMA15.0 Cas9
Plasmid#138944PurposeFungal AMA1 plasmid with sp-Cas9, ribozymes based "plug-and-play" sgRNA transcription unit, Terbinafine and Phleomycin selection markersDepositorInsertp40S:sp_Cas9_2xNLS; HH-HDV sgRNA transcription unit, Terbinafine (ergA) and Phleomycin (ble) selection markers
UseCRISPR and Synthetic Biology; Ama1 autonomously r…TagsNLSPromoterp40S (AN0465) Aspergillus nidulansAvailable sinceJan. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
plko.1/shMCT4 #474
Plasmid#99597PurposeKnockdown of MCT4 expressionDepositorInsertMCT4 (SLC16A3 Human)
UseLentiviralAvailable sinceOct. 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
p206-Switch-ON
Plasmid#217885PurposeRetroviral Switch-ON vector for sgRNA expression; U6-BbsIx2-SWITCH-ON-scaffold; neoRDepositorTypeEmpty backboneUseCRISPR, Cre/Lox, and RetroviralExpressionMammalianPromoterhU6Available sinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pE-35S-miniSdd7-nCas9-PBE-GmPPO2
Plasmid#204855PurposeFor cytosine base editing using miniSdd7 at PPO2 site in soybean (Agrobacterium-mediated transformation)DepositorInsertminiSdd7-nSpCas9(D10A)-UGI-mScarlet
UseCRISPRExpressionPlantMutationD10A in SpCas9Promoter35S, AtU6-26pAvailable sinceAug. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-FOXM1-shRNA-81
Plasmid#89497PurposeLentiviral vector with dox inducible expression of shRNA targeting human FOXM1.DepositorInsertFOXM1 (FOXM1 Human)
UseLentiviral and RNAi; Doxycycline inducibleExpressionMammalianPromoterH1/TOAvailable sinceJune 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-sh-mSlug-3
Plasmid#40647DepositorPublicationAvailable sinceSept. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pAdTrack: shRev-Erbalpha
Plasmid#22749DepositorAvailable sinceJune 2, 2010AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-1
Plasmid#8878DepositorPublicationAvailable sinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
p2T-CAG-SpCas9-BlastR
Plasmid#107190PurposeConfers constitutive expression of SpCas9DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 (NEWENTRY )
UseCRISPRTags3xFLAGExpressionBacterial and MammalianPromoterChicken ß-actinAvailable sinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pX330-MGAT1-KO
Plasmid#80009PurposegRNA to knock out expression of MGAT1 gene. The product of this gene is essential for synthesis of complex and hybrid N-Glycans.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMGAT1 (MGAT1 Human)
UseCRISPRAvailable sinceJuly 25, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-GFP (PX458)
Plasmid#129026Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pST_119_LVL2 cam
Plasmid#179333PurposeNT-CRISPR plasmid for integration of multiple gRNAs.DepositorInsertPtac tfoX, Ptet cas9, PJ23106 acrIIA4, sfGFP dropout to be replaced with gRNAs
UseCRISPRAvailable sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLL3.7-TNFa-shRNA3
Plasmid#72598PurposeExpress shRNA against mouse TNF-alphaDepositorAvailable sinceJan. 11, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDECKO_Malat1_D
Plasmid#72623PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_Malat1_E
Plasmid#72624PurposeExpresses two gRNAs targeting MALAT1 promoterDepositorInsertgRNAs toward Malat1
ExpressionMammalianPromoterU6 (gRNA1) and H1 (gRNA2)Available sinceJune 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
CHyMErA LbCas12a Nuclease Optimization hgRNA Library
Pooled library#209734PurposeCHyMErA Cas12a Nuclease Optimization hgRNA Libraries allows assessment and comparison of the efficacy of different LbCas12a nucleases in the context of the Cas9-Cas12a CHyMErA system.DepositorExpressionMammalianUseCRISPR and LentiviralAvailable sinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only