We narrowed to 10,315 results for: otos
-
Plasmid#228301Purpose2,4-Diacetylphloroglucinol (DAPG)-regulatable expression of SARS-CoV-2 RBD omicron variantDepositorInsertMFalpha(2xAdv)-SARS CoV-2 receptor binding domain (RBD)-His (S Severe acute respiratory syndrome-related coronavirus 2, Synthetic)
UseSynthetic BiologyTagsGGG linker followed by His6 and MF_ secretion sig…ExpressionYeastMutationG339D, S371L, S373P, S375F, K417N, N440K, G446S, …Promoter2,4-Diacetylphloroglucinol-regulatable synthetic …Available SinceMarch 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-SNAP-p53DD-IRES-HRAS(G12V)-bGH
Plasmid#233204PurposeAAV expression of SNAP-p53DD and HRAS(G12V)DepositorUseAAVExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW-SNAP-p53DD-IRES-HRAS(G12V)
Plasmid#233206PurposeLentiviral dox-inducible expression of SNAP-p53DD and HRAS(G12V)DepositorUseLentiviralExpressionMammalianMutationG12VAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET28 MBP-TEV-Rat BCKDK-His
Plasmid#232119PurposeFor bacterial expression of His-tagged Rat BCKDK (AA31-412, missing precursor peptide) with a cleavable MBP purification tag.DepositorInsertBCKDK (Bckdk Rat)
Tags6 x His, Maltose-Binding Protein (MBP), and Tev S…ExpressionBacterialPromoterT7 PromoterAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMVtrunc msfGFPΔC10-Utr28-222
Plasmid#231558PurposeExpresses N- and C-terminally truncated Utrophin calponin homology domain fused to C-terminally truncated msfGFP for actin filament organization measurements using fluorescence polarization microscopyDepositorInsertUtrophin calponin homology domain (UTRN Human)
TagsmsfGFPExpressionMammalianPromoterCMVtruncAvailable SinceJan. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
Anti-NSD1 [N312/10-2b] - Chimeric
Plasmid#227028PurposeMammalian expression plasmid of anti-NSD1 (Human). Derived from hybridoma N312/10.DepositorInsertAnti-NSD1 (Homo sapiens) recombinant mouse monoclonal antibody. (NSD1 Mouse)
UseAffinity Reagent/ AntibodyExpressionMammalianPromoterDual CMVAvailable SinceJan. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
AURKA-Aquamarine
Plasmid#228564PurposeEncodes a donor-only, Aquamarine-tagged version of the AURKA biosensor under the control of a CMV promoterDepositorAvailable SinceJan. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA2-dCas9-KRAB-TagBFP2 (identifier AAAA-0246)
Plasmid#202555PurposeSynaptotagmin-1 sgRNA2 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCAGTACTCGCGTGCCTCGCACCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA3-dCas9-KRAB-TagBFP2 (Identifier AAAA-0247)
Plasmid#202556PurposeSynaptotagmin-1 sgRNA3 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ - CACCTCCTCCTGCAGCGGCAGCATCGG) (Syt1 Rat)
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-RnSyt1-sgRNA1-dCas9-KRAB-TagBFP2 (identifier AAAA-0245)
Plasmid#202554PurposeSynaptotagmin-1 sgRNA1 with TagBFP2DepositorInsertCRISPRi single guide RNA sequence against 5’-UTR of rat synaptotagmin-1 (Syt1) gene (insert 5’ -CACCGCGTGCCTCGCACCGGTCCGCGG) (Syt1 R. norvegius (gRNA))
UseCRISPR and LentiviralTags3xFlag (N-terminus of Cas9-KRAB), T2A-TagBFP2Available SinceDec. 12, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X K181E
Plasmid#225714PurposeBacterial expression of USP27X (K181E) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro 3XFLAG-hATXN7L3
Plasmid#225725PurposeTransfection of ATXN7L3 with 3XFLAG tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X S404N
Plasmid#225724PurposeTransfection of USP27X (S404N) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X F313V
Plasmid#225722PurposeTransfection of USP27X (F313V) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X K181E
Plasmid#225721PurposeTransfection of USP27X (K181E) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X Y144C
Plasmid#225720PurposeTransfection of USP27X (Y144C) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAGGS puro HA-hUSP27X G76S
Plasmid#225719PurposeTransfection of USP27X (G76S) with HA tag in mammalian cellsDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X S404N
Plasmid#225717PurposeBacterial expression of USP27X (S404N) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X Y381H
Plasmid#225716PurposeBacterial expression of USP27X (Y381H) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGEX6P1 GST-hUSP27X F313V
Plasmid#225715PurposeBacterial expression of USP27X (F313V) with GST tagDepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only