We narrowed to 14,780 results for: sta
-
Plasmid#8492DepositorInsertHoxA9 (Hoxa9 Mouse)
TagsHis and T7ExpressionBacterialMutationBamHI/BalI fusion into amino acid #2 of HOXA9; ma…Available sinceMay 30, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLEXm-hCD45d
Plasmid#247052PurposeFor mammalian expression of human CD45 domains 1 and 2 with C-terminal Maltose-Binding Protein fusion for secretion into the mediumDepositorInserthCD45d1d2-MBP
TagsHis6 and Maltose binding protein (MBP)ExpressionMammalianMutationDomains 1 and 2 only, corresponding to residues 2…Promoterchick β-actin promoterAvailable sinceFeb. 19, 2026AvailabilityAcademic Institutions and Nonprofits only -
pBSII-PGK-FLPo-IRES-Puro
Plasmid#205989PurposeExpresses Flp recombinase and puromycin resistanceDepositorAvailable sinceOct. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pPSt_35Spr-GFP-t35S
Plasmid#203592PurposeFully assembled Plant STARR-seq plasmid with the 35S terminator.DepositorInsertsCaMV 35S promoter + Zm00001d041672 5'UTR
eGFP
CaMV 35S terminator
ExpressionPlantAvailable sinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
kanMX6-ins1
Plasmid#195038PurposepFA6a derived selection cassette flanked with transcription terminators (tDEG1/tDEG1), allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertKanR
UseYeast genomic targetingTagsS. cerevisiae DEG1 terminator, A. gossypii TEF pr…Available sinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
SUMO3_pcDNA6.2/EmGFP-Bsd
Plasmid#176949PurposeMammalian expression vector encoding SUMO3 and EmGFP-BsdDepositorAvailable sinceApril 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGBW-m4164344
Plasmid#153554PurposeMammalian expression plasmid for SARS-CoV-2 S (surface glycoprotein)DepositorInsertSARS-CoV-2 S (surface glycoprotein) (S Severe acute respiratory syndrome coronavirus 2)
Tagsaccatg Kozak-START linkerExpressionMammalianMutationGordon et al recodedAvailable sinceJune 16, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
GST-GRP78-Full Length (pGEX4T1)
Plasmid#238421PurposeExpresses GRP78 Full Length fused to the GST TagDepositorAvailable sinceAug. 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRXIB-mRuby3-CERT(PHD)
Plasmid#221762PurposeStable expression of mRuby3-CERT(PHD) in mammalian cellsDepositorInsertCERT (CERT1 Human)
UseRetroviralTagsmRuby3ExpressionMammalianMutationamino acids 1–116Available sinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-CERT(PHD)
Plasmid#221746PurposeStable expression of GFP-CERT(PHD)in mammalian cellsDepositorAvailable sinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGG-NES-TurboID-GFP
Plasmid#209401PurposeTransiently expressing and visualizing the subcellular localization of TurboID fused with a nuclear export signal (NES) in plantaDepositorInsertNES-3XHA-TurboID
TagsGFPExpressionPlantMutationTurboID gene sequence C249APromoterCauliflower mosaic virus (CaMV) 35S promoterAvailable sinceJan. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
phROSA26-Tet-HA-JSAP1_WT
Plasmid#208772PurposeTetracycline inducible expression vector for HA-JSAP1_WT, used as a donor plasmid for HA-JSAP1_WT knock-in at the human ROSA26 locusDepositorAvailable sinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
piggyBac_rtTA (4th_Gen)_Gateway_IRES_NGN2-2A-PURO_Synapsin-BirA. (pEHA1618)
Plasmid#209084PurposeNgn2 mediated cortical neuron induction, gateway destination, Synapsin promoter BirA ligase expressionDepositorAvailable sinceNov. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
EGFP-INPP5E-CAAX
Plasmid#202746Purposeexpress plasma membrane targeted fluorescent protein-tagged enzymeDepositorAvailable sinceJuly 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDF-Az
Plasmid#197101PurposeTo express the azidophenylalanine-specific variant of Methanocaldococcus jannaschii TyrRS and its cognate amber suppressor tRNA and allow UAG codon to be translated into azidophenylalanineDepositorInsertTyrRS variant, amber suppressor tRNA, kanamycin resistance gene
ExpressionBacterialMutationThr32, Asn107, Pro158, Leu159, Gln162, Arg286 (Ty…Available sinceJune 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRK5-Myc-PSK2
Plasmid#197117PurposeExpression of Myc-tagged PSK2 / TAOK1 in mammalian cellsDepositorAvailable sinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Affibody EGFR:1907.BirA*-pET301/NT-DEST
Plasmid#174691PurposePlasmid encoding for the bacterial expression of a bispecific coding for the anti-EGFR affibody ZEGFR:1907 fused to the mutated form of BirA enzyme, BirA*DepositorInsertAnti-EGFR affibody ZEGFR:1907 fused to mutated form of BirA, BirA*
TagsHIS tagExpressionBacterialMutationR118G mutation in BirAPromoterT7 promoterAvailable sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBbsr2-Necl-5-ScNeo
Plasmid#170283PurposeTo monitor the status of Necl-5, the plasmid encodes a recombinant Necl-5 fused extracellularly to the mScarlet fluorescent protein and intracellularly to the mNeonGreen fluorescent proteinDepositorInserta recombinant mouse Necl-5 fused to the mScarlet and to the mNeonGreen fluorescent protein (Pvr Mouse, Synthetic)
TagsmScarlet and mNeonGreenExpressionMammalianAvailable sinceJune 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
BPV00554 pET21GG2-His(6)-BECN(248-450)
Plasmid#136685PurposeExpresses the Beclin-1 ECD/BARA domain (a.a. 248-450) with a N-terminal hexa-Histidine tagDepositorInsertBeclin-1 ECD/BARA (BECN1 Human)
TagsHexa-HistadineExpressionBacterialMutationDNA optimized for E. coli expressionPromoterT7Available sinceFeb. 14, 2020AvailabilityAcademic Institutions and Nonprofits only