We narrowed to 12,617 results for: LIC
-
Plasmid#100782PurposeMammalian expression of BNIP3 delta Exon2 splice variantDepositorInserthuman-BNIP3 delta Exon2 (BNIP3 Human)
TagsHAExpressionMammalianMutationExon2 deletionPromoterCMVAvailable sinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pmEos2-Linker_PCNA-MutC
Plasmid#98272Purposefor low level expression of mEos2-PCNA in mammalian cellsDepositorInsertPCNA (PCNA Human)
TagsmEos2ExpressionMammalianMutationSilent mutated Sequence: GACGCCGTAGTTATATCTTGC (O…PromoterCMVAvailable sinceJuly 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 G260E mutant
Plasmid#67610Purposebacterial expression of GST-PRMT9 G260E Double E loop mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationG260E double E loop mutantPromotertacAvailable sinceJune 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
GST-PRMT9 D258G mutant
Plasmid#67609Purposebacterial expression of GST-PRMT9 D258G Double E loop mutantDepositorInsertPRMT9 (PRMT9 Human)
TagsGSTExpressionBacterialMutationD258G double E loop mutantPromotertacAvailable sinceJune 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pET28A-p53 (1-73) (P27A)
Plasmid#62068PurposeExpression of human p53 (1-73) (P27A) in e. coliDepositorInsertp53 (TP53 Human)
TagsHisExpressionBacterialMutationContains TAD residues 1-73; P27APromoterT7Available sinceJan. 28, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTFP1-H4-23
Plasmid#55491PurposeLocalization: Nucleus/Histones, Excitation: 462, Emission: 492DepositorAvailable sinceOct. 2, 2014AvailabilityAcademic Institutions and Nonprofits only -
psicheck-2-Casp8
Plasmid#48172Purposecontains Renilla Luciferase gene preceded by an intact (ATG) upstream open reading frame elementDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsert5" UTR of CASP8 (CASP8 Human)
UseLuciferaseAvailable sinceOct. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-PRKRA
Plasmid#31571DepositorInsertprotein kinase, interferon-inducible double stranded RNA dependent activator (PRKRA Human)
TagsHis and TEVExpressionBacterialAvailable sinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
pQTEV-C21orf7
Plasmid#34810DepositorAvailable sinceMarch 22, 2013AvailabilityAcademic Institutions and Nonprofits only -
PECR
Plasmid#39158PurposeBacterial expression for structure determination; may not be full ORFDepositorAvailable sinceMarch 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
pFastBac-His-Tipin-L195A
Plasmid#23121DepositorAvailable sinceMarch 3, 2010AvailabilityAcademic Institutions and Nonprofits only -
pET-28b(+)-DR RecR(34-220)
Plasmid#12618DepositorPublicationInsertDeinococcus radiodurans RecR(34-220)
TagsHisExpressionBacterialMutationdeleted amino acids 1-33Available sinceJan. 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
pCZGY553
Plasmid#110883PurposePmec-4 Gateway Destination vector for cloning for expression in C. elegans mechanosensory neuronsDepositorInsertPmec-4
UseGateway CloningAvailable sinceOct. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
His8-TEV-PseC
Plasmid#89724PurposeExpresses PseC from C. jejuni with an N-terminal octaHis tag and TEV cleavage siteDepositorAvailable sinceFeb. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pZA-mCherry-R5
Plasmid#106258PurposeExpresses mCherry fused with silaffin-R5 silica affinity peptide under the control of TetODepositorInsertmCherry
TagsAdded silaffin R5 peptide to C terminus of mCherr…ExpressionBacterialAvailable sinceOct. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
p3E-YFP-HA no-pA
Plasmid#82590Purpose3' entry vector containing HA epitope fused to C-terminus of YFP without pA for imaging, epitope labeling/purificationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertYFP-HA (no pA)
PromoterNoneAvailable sinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
p3E-mCherry-HA no-pA
Plasmid#82592Purpose3' entry vector with HA epitope fused to C-terminus of mCherry without pA for imaging, epitope labeling/purificationDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertmCherry-HA (no pA)
PromoterNoneAvailable sinceDec. 21, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas5
Plasmid#82378PurposesgRNA targeting YFP expressed from pJ23119 in the NS1 locus with kanamycin resistanceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA
PromoterPJ23119Available sinceNov. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pPK1E-1-gfp
Plasmid#48133PurposeShuttle vector E. coli/B.meg.; gfp-expression under control of RNAP-K1E-inducible promoterDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable sinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only -
pPK1E-2+t-gfp
Plasmid#48132PurposeShuttle vector E. coli/B.meg.; gfp-expression under control of RNAP-K1E-inducible promoterDepositorInsertgfp
UseSynthetic BiologyExpressionBacterialAvailable sinceOct. 21, 2013AvailabilityAcademic Institutions and Nonprofits only