We narrowed to 22,858 results for: nar
-
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPD765 TRE3GV MCS in TU1
Plasmid#139253PurposeTRE3GV promoter and an MCS in TUPV1DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD765 TRE3GV MCS in TU1
Plasmid#139253PurposeTRE3GV promoter and an MCS in TUPV1DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD767 TRE3GV MCS in TU4
Plasmid#139256PurposeTRE3GV promoter and an MCS in TUPV4DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD767 TRE3GV MCS in TU4
Plasmid#139256PurposeTRE3GV promoter and an MCS in TUPV4DepositorTypeEmpty backboneUseSynthetic BiologyExpressionMammalianAvailable SinceFeb. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1159 pLink 9
Plasmid#139247PurposeVector that holds the linker for circuits with 9 TUsDepositorInsertLinker9
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1159 pLink 9
Plasmid#139247PurposeVector that holds the linker for circuits with 9 TUsDepositorInsertLinker9
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1158 pLink 8
Plasmid#139246PurposeVector that holds the linker for circuits with 8 TUsDepositorInsertLinker8
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1158 pLink 8
Plasmid#139246PurposeVector that holds the linker for circuits with 8 TUsDepositorInsertLinker8
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1157 pLink 7
Plasmid#139245PurposeVector that holds the linker for circuits with 7 TUsDepositorInsertLinker7
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1157 pLink 7
Plasmid#139245PurposeVector that holds the linker for circuits with 7 TUsDepositorInsertLinker7
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1156 pLink 6
Plasmid#139244PurposeVector that holds the linker for circuits with 6 TUsDepositorInsertLinker6
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1156 pLink 6
Plasmid#139244PurposeVector that holds the linker for circuits with 6 TUsDepositorInsertLinker6
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1155 pLink 5
Plasmid#139243PurposeVector that holds the linker for circuits with 5 TUsDepositorInsertLinker5
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1155 pLink 5
Plasmid#139243PurposeVector that holds the linker for circuits with 5 TUsDepositorInsertLinker5
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1154 pLink 4
Plasmid#139242PurposeVector that holds the linker for circuits with 4 TUsDepositorInsertLinker4
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1154 pLink 4
Plasmid#139242PurposeVector that holds the linker for circuits with 4 TUsDepositorInsertLinker4
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1153 pLink 3
Plasmid#139241PurposeVector that holds the linker for circuits with 3 TUsDepositorInsertLinker3
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1153 pLink 3
Plasmid#139241PurposeVector that holds the linker for circuits with 3 TUsDepositorInsertLinker3
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPD1152 pLink 2
Plasmid#139240PurposeVector that holds the linker for circuits with 2 TUsDepositorInsertLinker2
UseSynthetic BiologyAvailable SinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits only