We narrowed to 118,634 results for: MPI
-
Plasmid#209303PurposeExpression plasmid for GEM7 (encapsulin from R. rubrum) with C-terminal HaloTag suitable for expression in mice via in utero electroporationDepositorInsertGEM7
UseAAVTagsHaloTagAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pAAV-hSynI-EGFP-WPRE-hGH poly(A) (Alex_02)
Plasmid#71651PurposeAAV expression of EGFP in human and mouse neuronsDepositorInsertEGFP
UseAAVExpressionMammalianAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSyncytin-1(deltaFP)
Plasmid#182443PurposehSyncytin-1, fusion peptide deletion(320-340)DepositorInsertERVW-1 (ERVW-1 Human)
ExpressionMammalianMutationno fusion peptide (320-340)PromoterCMV-FAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-hSyncytin-1(C186A)
Plasmid#182450PurposehSyncytin-1, fusion deficit and dominant negative mutant (C186A)DepositorAvailable SinceApril 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE-FRT-MCS-WPRE-SV40 - GCH27
Plasmid#230828PurposeAAV cloning vector for Flpo-dependent expression under the TRE promoter.DepositorTypeEmpty backboneUseAAV; Cloning vector, flp/frtAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG Retro EGFP Puro
Plasmid#234463PurposeControl retroviral vector expressing Green Fluorescent Protein. Puromycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAG Retro EGFP Hygro
Plasmid#234462PurposeControl retroviral vector expressing Green Fluorescent Protein. Hygromycin selection.DepositorInsertGreen Fluorescent Protein
UseRetroviralAvailable SinceMarch 21, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_THADA_pos1toneg0
Plasmid#232388PurposeTHADA enhancer, one sensitizing element made into buffering CoordinatorDepositorInsertTHADA (THADA Human)
UseLuciferaseMutationTHADA enhancer, one sensitizing element made into…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_bothneg0scramble
Plasmid#232383PurposeMSR1 enhancer, both buffering Coordinators scrambledDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_FAM153CP_SOX9rep
Plasmid#232400PurposeEnhancer near FAM153CP, buffering element replaced with SOX9 siteDepositorInsertFAM153CP (FAM153CP Human)
UseLuciferaseMutationEnhancer near FAM153CP, buffering element replace…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only