We narrowed to 1,444 results for: aav vector plasmid
-
Plasmid#67637PurposeAAV vector expressing PGC1a geneDepositorInsertPGC1a (Ppargc1a Mouse)
UseAAVTags6XHis and Flag tagExpressionMutationPromoterCMVAvailable sinceApril 26, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-miniDq-P2A-mCherry
Plasmid#204357PurposeAAV vector for miniDq expression under the control of human synapsin promoterDepositorInsertminiDq-P2A-mCherry
UseAAVTagsmCherryExpressionMutationThe third intracellular loop (ICL3) of hM3Dq was …PromoterhSynAvailable sinceOct. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-mScarlet-WPRE
Plasmid#130994PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagsmScarletExpressionMutationPromoterhSynAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV N-SpyCas9-Intein, U6-gRNA scaffold (F+E)
Plasmid#120293PurposeAAV Vector for expression of N-terminal SpyCas9 fragment with Intein and a U6-driven F+E gRNA scaffoldDepositorInsertN-terminal fragment of SpyCas9
UseAAV and CRISPRTagsSV40-NLS and split-inteinExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-eYFP-WPRE
Plasmid#130988PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagseYFPExpressionMutationPromoterCaMKIIaAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-ChRmine-eYFP-WPRE
Plasmid#130992PurposeAAV vector to drive the expression of ChRmine-eYFP under the control of human synapsin promoterDepositorInsertChRmine
UseAAVTagseYFPExpressionMutationPromoterhSynAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-ChRmine-mScarlet-WPRE
Plasmid#130990PurposeAAV vector to drive the expression of ChRmine-mScarlet under the control of CamKIIa promoterDepositorInsertChRmine
UseAAVTagsmScarletExpressionMutationPromoterCaMKIIaAvailable sinceSept. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-PdTK-CAG-mCh-[uBglII]
Plasmid#107280Purposepuro-deltaTK gene-trap selection cassette (AAVS1 donor vector backbone) with constitutive mCherryDepositorInsertAAVS1 puro-deltaTK; CAG-mCherry (PPP1R12C )
UseTagsExpressionMutationPromoterAvailable sinceMarch 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pOTTC446 - pAAV EF1a hPREP(S554A)
Plasmid#59968PurposeAn AAV packaging vector that expresses catalytically-inactive hPREP under control of the EF1a promoter.DepositorInsertProlyl oligopeptidase (PREP Human)
UseAAVTagsExpressionMammalianMutationS554APromoterEF1aAvailable sinceOct. 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MPRA-MluI-SpeI-EcoRI
Plasmid#190196PurposeEmpty vector for inserting MPRA libraries into AAVDepositorTypeEmpty backboneUseAAV; Massively parallel reporter assay (mpra)TagsExpressionMammalianMutationPromoterAvailable sinceFeb. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
vDip-C: pAAV-Pcp2-mGreenLantern-KASH
Plasmid#207613PurposevDip-C AAV vector with mouse Pcp2 (also known as L7) promoter driving green fluorophore mGreenLantern with a KASH nuclear membrane tag to isolate cell nuclei of cerebellar Purkinje cellsDepositorInsertmGreenLantern
UseAAVTagsKASHExpressionMutationPromotermouse Pcp2 promoter (L7-6)Available sinceOct. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Synthetic, Mouse)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-fDIO-mEGFP-Gphn_P1
Plasmid#194978PurposeAAV vector to drive the Flp-dependent expression of mEGFP (L221K) -Gphn (isoform P1) under the control of human Synapsin promoterDepositorInsertmEGFP-Gphn (isoform P1) (Gphn Synthetic, Rat)
UseAAVTagsmEGFPExpressionMutationPromoterAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV mGAD65(delE1) GFP WPRE SV40pA
Plasmid#177316PurposeTo produce the AAV vector that expresses GFP under the control of the mGAD65 promoter. The mGAD65 promoter has highly specificity to GABAergic interneurons.DepositorInsertmGAD65(delE1) promoter, GABAergic interneurons specific promoter
UseAAVTagsExpressionMutationPromoterAvailable sinceDec. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEXFRT-ChR2(H134R)-mCherry
Plasmid#75470PurposeFlp-dependent Chr2-mCherry encoded in an AAV vector for rAAV production and expression in mammalian cellsDepositorHas ServiceAAV1InsertReversed ChR2(H134R)-mCherry
UseAAV and Synthetic BiologyTagsExpressionMammalianMutationPromoterCAGAvailable sinceJuly 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCAG eGFP T2A SP HALO HAPLN1
Plasmid#228200PurposeAAV vector expressing GFP and HaloTag-HAPLN1 under constitutive promoterDepositorInsertHAPLN1 (Hapln1 Mouse)
UseAAVTagsExpressionMammalianMutationPromoterconstitutive CAG promoterAvailable sinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-myrmScarlet-I-P2A-post-eGRASP
Plasmid#111584PurposeAn AAV vector that expresses myristoylated mScarlet-I and post-eGRASP linked by self-cleaving P2A peptide under the tetO promoter.DepositorInsertmyrmScarlet-I-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromotertetOAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-TIWB-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111590PurposeAn AAV vector that expresses myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the tetO promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromotertetOAvailable sinceJune 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hGFAP-Pink Flamindo-WPRE-SV40
Plasmid#178790PurposeAAV vector to express the red cAMP indicator in astrocytesDepositorInsertPink Flamindo
UseAAVTagsExpressionMutationPromoterhGFAPAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only