We narrowed to 12,230 results for: nsf
-
Plasmid#204689PurposeFluorescent reporter under the control of the Dlx promotorDepositorInsertmScarlet
UseAAV and Cre/LoxTagsmScarlet palmitoylationExpressionMammalianPromotermDlxAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSBL_DK202
Plasmid#156426PurposeMammalian expression of 3a delta N(aa 42-275)-EGFP with CMV promoter, can be used for transfection or used to generate bacmids for baculoviral infection of mammalian cellsDepositorInsertSARS-CoV-2 3a protein (aa 42-275)
TagsEGFP-HisExpressionMammalianMutationaa 42-275PromoterCMVAvailable SinceJuly 21, 2020AvailabilityAcademic Institutions and Nonprofits only -
RhopH3-bio
Plasmid#47781PurposeExpresses enzymatically monobiotinylated full-length RhopH3 with no N-linked glycans upon cotransfection with BirA in mammalian cells. Contains a C-terminal rat Cd4 d3+4 tag.DepositorInsertCodon-optimised RhopH3
Tagsenzymatic biotinylation sequence and rat Cd4 d3+4ExpressionMammalianMutationExogenous signal peptide of mouse origin, changed…PromoterCMVAvailable SinceFeb. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
LLP789_αGCN4-DNMT3A-CO
Plasmid#211783PurposeSunTag counterpart binding domain, aGCN4, fused to DNA methyltransferase DNMT3A, with GFP selectionDepositorInsertaGCN4-DNMT3A
Tags3xTy1ExpressionMammalianMutationLast 300 bp codon optimised (CO) to detect DNMT3A…PromoterpEF1a and pSV40Available SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAav-MCS-PQS2-3xHA
Plasmid#84917PurposerAAV-based template for genome engineering of protein C-termini containing PQS2 and 3xHA tags and a selection cassetteDepositorInsertLOX-PGK-NEO-LOX
UseAAVTagsPQS2 3xHAPromotermPGKAvailable SinceNov. 28, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-nirButterfly
Plasmid#136591PurposeAAV plasmid for CaMKII-driven expression of a genetically-encoded voltage indicator nirButterflyDepositorInsertnirButterfly
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV2_hSyn_NES-Caprola_04-mEGFP_WRPE-SV40
Plasmid#194688PurposehSyn1 driven expression of the calcium recorder Caprola_04 fused to mEGFP for neuronal expression through AAV transductionDepositorInsertCaprola_04-mEGFP
UseAAVTagsmEGFPPromoterhSyn1Available SinceFeb. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Lrat
Plasmid#206345PurposeAAV plasmid expressing LRAT in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-eYFP-3x-miR204-5p-TS
Plasmid#117380PurposeAn AAV genome containing miRNA target sequence (TS) 204-5p to reduce expression of the fluorescent protein eYFP in astrocytesDepositorInsertEYFP + 3 copies of miR204 : AGGCATAGGATGACAAAGGGAA
UseAAVExpressionMammalianPromoterCAGAvailable SinceOct. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-iCre-2A-venus
Plasmid#182499PurposeExpresses iCre-venus. The promoter is a fragment of the hdc gene promoter that gives pan neuronal expressionDepositorInsertiCre-2A-Venus
UseAAV and Cre/LoxExpressionMammalianPromoterfragment of histidine decarboxylase gene promoter…Available SinceMarch 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCA-T-intron(Neo)-G(LNL)
Plasmid#36908DepositorInsertsT (i.e., ATG, start codon as a first exon)
GFP
beta-globin intron
Neo
ExpressionMammalianMutationdeleted nucleotides before nucleotide 275 and ins…PromoterCAG (chicken beta actin promoter and CMV enhancer…Available SinceAug. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
pTS115 pHAGE2 CMVtetO2 MCS-3C-SUMOstar-22xGS-Alfa-P2A-TagBFP
Plasmid#199368PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally 3C-SUMOstar-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTags3C-SUMOstar-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Susd4(3.7)-EGFP-sv40
Plasmid#184413PurposeAAV expression of tTA from mouse sushi domain containing 4 (Susd4) gene promoter.DepositorInsertMouse Susd4 gene promoter-EGFP (Susd4 Mouse)
UseAAVTagsEGFPExpressionMammalianPromoterMouse Susd4 geneAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEA02
Plasmid#172193PurposeSuicide vector carrying the site attL of the SSR system of pSAM2. This plasmid is integrated into the genome of Actinobacteria by HR when carrying a DNA fragment identical to a region of the genome.DepositorInsertattL
ExpressionBacterialAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xG1 PylT sfGFP 150TAG
Plasmid#154767Purposeplasmid with 4xG1 PylT cassette and amber suppression reporter sfGFP 150 TAG stop, for transient transfection or stable, piggybac-mediated, integrationDepositorInsertsfGFP
ExpressionMammalianMutation150TAGPromoterEF1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
aav-CAG-FLEX-tdNfsB(F124W)-mCherry (eNTR)
Plasmid#113762PurposeAAV-mediated conditional expression of bacterial tdNfsB-mCherry (eNTR) under the CAG promoterDepositorInserttdNfsB(F124W)-mCherry
UseAAV and Cre/LoxTagsmCherryExpressionMammalianMutationF124WPromoterCAGAvailable SinceSept. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hRREB1-RFP
Plasmid#22924DepositorInserthuman ras responsive element binding protein 1 driving DsRedExpress (RREB1 Human)
UseAAVExpressionMammalianAvailable SinceMay 25, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-synp-F-H2B-GCaMP6f
Plasmid#102994PurposeExpresses histone fused GCaMP6f under the synapsin promoterDepositorInsertH2B-GCaMP6f
UseAAVExpressionMammalianPromoterhuman synapsin I promoterAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAM-AAV-mSncg-0.66kb-EGFP
Plasmid#153165PurposeTruncated mouse gamma-synuclein (mSncg-0.66kb) promoter-mediates gene expression in retinal ganglion cells with fluorescent reporterDepositorTypeEmpty backboneUseAAVExpressionMammalianAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1α-FRT-FLEX-GtACR2-EYFP-Kv2.1C-TlcnC
Plasmid#114376Purposeexpresses Flpo recombinase-dependent GtACR2-Kv2.1C-TlcnC, which targets GtACR2 to the somatodendritic compartmentDepositorInsertGtACR2-EYFP-Kv2.1C-TlcnC (NEWENTRY )
UseAAVTagsEYFP, Kv2.1C, and TlcnCExpressionMammalianPromoterEf1aAvailable SinceAug. 24, 2018AvailabilityAcademic Institutions and Nonprofits only