We narrowed to 9,809 results for: crispr plasmids
-
Plasmid#214034PurposeBacterial expression plasmid for strep-tagged PCaspase (Prokaryotic Caspase) from Haliangium ochraceumDepositorInsertPCaspase
TagsStrep-tag IIExpressionBacterialMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJS-BCD-Strep-PC-σ
Plasmid#214037PurposeBacterial expression plasmid for strep-tagged PC-σ from Haliangium ochraceumDepositorInsertPC-σ
TagsStrep-tag IIExpressionBacterialMutationWTPromoterT7 promoterAvailable SinceJune 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EhT
Plasmid#215546PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EPG
Plasmid#215545PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived puromycin-GFP selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-gRNA
Plasmid#215547PurposegRNA targeting B2M to introduce splice donor mutation on the first intron of the locusDepositorInsertB2M (B2M Human)
UseCRISPRAvailable SinceMarch 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_1
Plasmid#210625PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_2
Plasmid#210622PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_1
Plasmid#210621PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_4
Plasmid#210624PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_-60_Enh_3
Plasmid#210623PurposegRNA target sequences for TAL1 -60 EnhancerDepositorInsertTAL1 -60 Enhancer gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_2
Plasmid#210626PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_3
Plasmid#210627PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSPgRNA_Ex3_4
Plasmid#210628PurposegRNA target sequences for TAL1 Exon 3DepositorInsertTAL1 Exon 3 gRNA (TAL1 Human)
UseCRISPRAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
IR76b-T2A-QF2
Plasmid#162523PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir76b geneDepositorInsertIr76b-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir76b-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
GR3-T2A-QF2
Plasmid#162521PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Gr3 geneDepositorInsertGr3-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Gr3-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
IR8a-T2A-QF2
Plasmid#162520PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir8a geneDepositorInsertIr8a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir8a-right-HDR-arm
ExpressionInsectAvailable SinceMay 19, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-TBG-Cre-sgArid1a
Plasmid#192165PurposeAAV-TBG-Cre-sgArid1aDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-TBG-Cre-sgKmt2d
Plasmid#192164PurposeAAV-TBG-Cre-sgKmt2dDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
IR25a-T2A-QF2
Plasmid#162522PurposePlasmid for CRISPR-mediated knock-in line that expresses a QF2 transcriptional activator by knocking-in a T2A-QF2 fragment replacing the stop codon of the endogenous Aedes aegypti Ir25a geneDepositorInsertIr25a-left-HDR-arm; T2A-QF2-SV40; 3xP3-dsRed-SV40; Ir25a-right-HDR-arm
ExpressionInsectAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only