We narrowed to 29,208 results for: INO
-
Plasmid#191013PurposeExpresses EGFP-tagged MASTL with E167D mutation and resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianMutationE167DAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
mGFP-hNET
Plasmid#193364Purposeexpression of human norpinephrine transporter tagged with monomeric GFP at the N-terminus in mammalian cellsDepositorInserthuman Norepinephrine Transporter (SLC6A2 Human)
Tagsmonomeric GFP (mGFP)ExpressionMammalianPromoterCMVAvailable SinceJan. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV pCAG-FLEX2-tTA2-WPRE-bGHpA
Plasmid#65458PurposeCan be used to generate AAV virus that will express the tetracycline transactivator tTA2 from the CAG promoter in a Cre-dependent mannerDepositorInserttTA2
UseAAVPromoterCAGAvailable SinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
PB53x EF1-Dendra2-RPB1Amr
Plasmid#81228Purposeexpresses Dendra2-Rpb1 fusion in mammalian cells. Possible to insert into the genome using the Piggibac systemDepositorInsertDendra2 - Rpb1 (alpha amanitin resistant) (POLR2A Human)
TagsDendra2ExpressionMammalianMutationN792D alpha amanitin resistance mutation (Bartolo…PromoterEF1aAvailable SinceNov. 7, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCDH-kz-CD20-Puro
Plasmid#209759PurposeLentiviral transfer plasmid to express the CDS of the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-AMBRA1-3xFLAG
Plasmid#172605PurposeExpresses 3xFLAG-tagged AMBRA1 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSH-Csy4-T2A-SpRFN
Plasmid#85754PurposeExpresses S. pyogenes FokI-dCas9-NLS with a 25 amino acid linker (GGGGS)5 fusion. Also expresses Csy4 for cleavage of multiplexed gRNA transcripts. Derived from pSQT1601 (Addgene #53369).DepositorInsertCsy4-T2A-FokI-dCas9
UseCRISPRTagsCsy4 and FokI fusion via 25 amino acid (GGGGS)5 l…ExpressionMammalianMutationD10A, H840APromoterCAGAvailable SinceJan. 20, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Foff 2.0-ChR2(ET/TC)-EYFP
Plasmid#137140PurposeIntersectional viral expression of ChR2(ET/TC)-EYFP in cells expressing Cre AND NOT FlpDepositorHas ServiceAAV8InsertCon/Foff 2.0-ChR2(ET/TC)-EYFP
UseAAV, Cre/Lox, and Synthetic Biology ; Flp/frtMutationE123T, T159CPromoternEFAvailable SinceJune 25, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSPL3-hRPH3A_c.444Gwt
Plasmid#190476Purposeminigene assayDepositorInsertRPH3A (NM_014954.3) c.444 [exon 7 and part of surrounding introns only] (RPH3A Human)
ExpressionMammalianPromoterSV40Available SinceSept. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMK297 (DHC1-mAID Hygro)
Plasmid#140542PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pMK296 (DHC1-mAID Neo)
Plasmid#140541PurposeDHC1 tagging with mAIDDepositorAvailable SinceNov. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-2xFLAG-2xSTREP-CDK2
Plasmid#172616PurposeExpresses 2xFLAG-2xSTREP-tagged CDK2 in mammalian cellsDepositorAvailable SinceAug. 20, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCDH-SFFV-GLuc-CreERT2-mCherry
Plasmid#178185Purposethe plasmid promotes the constitutive expression of CreERT2 to enable intracellular recombination, Gaussia Luc can be used for in vivo imaging and mCherry is used as a marker for ex vivo analyses.DepositorInsertsGLuc
CreERT2
mCherry
UseLentiviralAvailable SinceJan. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
Polymerase variant click editor (CE1) - pCMV-T7-PCV2-nCas9-Phi29 (JO582)
Plasmid#208954PurposeA variant CE1 construct with Phi29 DNA polymerase (-exo), expressed from CMV or T7 promoters.DepositorInsertPCV2-XTEN-nSpCas9-BPNLS-Phi29(-exo)-BPNLS
UseCRISPR; In vitro transcription; t7 promoterTagsBPNLSExpressionMammalianMutationnSpCas9(H840A), Phi29(-exo;D169A)PromoterCMV and T7Available SinceNov. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET-EIN-FTO(32-505)
Plasmid#186466PurposeExpresses human RNA demythelase protein FTO 32-505 amino acid sequence with N-terminal fusion with the N-domain of EI ( e.coli protein)DepositorInsertFat mass obesity associated protein (FTO Human)
Tags6 Histidine-EIN (N-terminal domain of E.coli Enzy…ExpressionBacterialMutationamino acid 32-505PromoterT7Available SinceJune 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3F
Plasmid#224447PurposeRep/Cap plasmid for the production of MyoAAV 3F, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDHASW insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBFC1171
Plasmid#231994PurposeCRISPRi-ART crRNA only plasmid encoding crystal violet-inducible crRNA (for dRfxCas13d) with 2xBsaI spacer cloning siteDepositorInsertcrRNA of dRfxCas13d
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterpJEx (Jungle Express)Available SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
kiCAP-AAV-MyoAAV3A
Plasmid#224442PurposeRep/Cap plasmid for the production of MyoAAV 3A, a muscle-tropic AAV capsid in mice and macaques.DepositorInsertAAV9 VP1 modified with 7mer insertion between amino acids 588 and 589
UseAAVMutationRGDYVGL insert between amino acids 588 and 589 of…Promoterp41Available SinceSept. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV phSyn1(S)-DreO-bGHpA
Plasmid#50363PurposeCan be used to generate AAV virus that will express DreO recombinase in neurons from the synapsin promoterDepositorHas ServiceAAV Retrograde and AAV5InsertDreO recombinase
UseAAVTagsnoneMutationSequence optimized for expression in mammalian ce…PromoterhSyn1Available SinceJan. 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
MEK1C222
Plasmid#164638PurposeBacterial expression plasmid for His6-MEK1C222DepositorInsertmitogen-activated protein kinase kinase 1 (MAP2K1 Human)
TagsHis6-tagExpressionBacterialMutationG(-19)F/S222C/C277S/C376SPromoterT7Available SinceMay 5, 2021AvailabilityAcademic Institutions and Nonprofits only