We narrowed to 944 results for: trna
-
Plasmid#166987PurposeTests for the impact of 4 uracil in conjunction with a hairpin structure in a poly-uracil tract on human polymerase III transcription from a GLN tRNA promoter.DepositorInsertTermination module:PolyU(4), Hairpin = 0 nt
ExpressionMammalianAvailable SinceApril 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEL052
Plasmid#137906PurposeOsBiP1 promoter driven Cas9-tRNA systemDepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT42
Plasmid#223414PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for monocot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-ecTadA8e-SpRY-D10A-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
720-2µ-maxHIS3
Plasmid#40612DepositorInsertHIS3 (HIS3 Synthetic, Budding Yeast)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceOct. 18, 2012AvailabilityAcademic Institutions and Nonprofits only -
pDule2-pCNF
Plasmid#85495PurposeMachinery plasmid expressing permissive pCNF synthetase and cognate amber suppressing tRNA. Incorporates azidoPhenylalanine.DepositorInsertpara-cyanophenylalanine Mj synthetase
TagsNoneExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoterlpp (constitutive)Available SinceFeb. 9, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDule-pCNF
Plasmid#85494PurposeMachinery plasmid expressing permissive pCNF synthetase and cognate amber suppressing tRNA. Incorporates azidoPhenylalanine.DepositorInsertpara-cyanophenylalanine Mj synthetase
TagsNoneExpressionBacterialMutationY32L L65V F108W Q109M D158G I159PPromoterlpp (constitutive)Available SinceJan. 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xEcoLeuT(CUA)_EF1_sfGFP150TAG
Plasmid#174892Purposeamber suppression reporter sfGFP150TAG with EcoLeuT(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xBstTyrT(CUA)_EF1 sfGFP150TAG
Plasmid#174891Purposeamber suppression reporter sfGFP150TAG expression, with BstTyr(CUA) amber suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TAG in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBK-EcTrpRS(H14)
Plasmid#231129PurposeExpresses mutant E. coli TrpRS from a weak glnS promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertE. coli tryptophanyl tRNA synthetase
ExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSGAb/pEvol-AbTrpRS(H14)
Plasmid#231133PurposeExpresses mutant A. baumannii TrpRS from an inducible lac promoter for proteome-wide incorporation of tryptophan analogues.DepositorInsertA. baumannii tryptophanyl tRNA synthetase
UseAcinetobacter baumannii expressionExpressionBacterialMutationT12A, V151G, V153CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT30
Plasmid#223402PurposeT-DNA vector for PmCDA1-CBE_V04 based C-to-T base editing for monocot plants; NGG PAM; 5' editing window; PmCDA1-CBE_V04 and the sgRNA was driven by separate ZmUbi1; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9D10A-PmCDA-UGI-T2A-MS2-UGI-ZmUbi-gRNA scaffold 2.0-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UUA)_EF1_sfGFP150TAA
Plasmid#174897Purposeochre suppression reporter sfGFP150TAA expression, with MmaPylT(UUA) ochre suppressor tRNA cassetteDepositorInsertsf GFP
ExpressionMammalianMutation150TAA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAS_4xMmaPylT(UCA)_EF1_sfGFP150TGA
Plasmid#174898Purposeopal suppression reporter sfGFP150TGA expression, with MmaPylT(UCA) opal suppressor tRNA cassetteDepositorInsertsfGFP
ExpressionMammalianMutation150TGA in sfGFPPromoterEF1Available SinceNov. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
719-2µ-minHIS3
Plasmid#40610DepositorInsertHIS3 (HIS3 Synthetic, Budding Yeast)
TagsHAExpressionYeastMutationEvery codon of the coding sequence has been repla…PromoterTDH3Available SinceDec. 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
pRARE-MBP-DEST
Plasmid#84650PurposeGateway cloning vector expresses MBP-tagged proteins under the control of the IPTG– inducible ptac promoter and also expresses several tRNAs that are rare in E. coli.DepositorTypeEmpty backboneTagsMBPExpressionBacterialPromotertacAvailable SinceSept. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pUltra-sY
Plasmid#82417PurposeExpresses Mj aaRS for sulfotyrosine and Mj tRNA for decoding UAG codonsDepositorInsertMethanococcus jannaschii aaRS for sulfotyrosine
ExpressionBacterialMutationTyr32Leu, Leu65Pro, Asp158Gly, Ile159Cys, Leu162L…PromotertacIAvailable SinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDIV313
Plasmid#204956PurposeAMA1 plasmid with Aspergillus optimized Mad7, hph (hygromycin) resistance marker and sgRNA targeting albA locus in A. nigerDepositorInsertsMad7
hph (hygromycin resistance marker)
sgRNA (CAGCAATGCTTCCATGCAATT) targeting albA locus in A. niger flanked by a tRNA-Gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialPromoterAspergillus fumigatus U3 promoter, Aspergillus ni…Available SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMV361_MjTyrRS
Plasmid#193250PurposeExpresses the M. jannaschii tyrosyl-tRNA synthetase (MjTyrRS)DepositorInsertMjTyrRS
ExpressionBacterialPromoterhsp60Available SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSC4
Plasmid#91182PurposeT-DNA vector for targeted deletion of 58kb region in Medicago truncatula (tRNA array of 6 gRNAs under the control of CmYLCV promoter)DepositorInsertgRNAs targeting 58kb region in medicago truncatula
UseCRISPRExpressionPlantAvailable SinceSept. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBBR1-EcTrpRS(H14)
Plasmid#231131PurposeExpresses mutant E. coli TrpRS from a derepressed lac promoter for proteome-wide incorporation of tryptophan analogues in E. coli/K. pneumoniae.DepositorInsertE. coli tryptophanyl tRNA synthetase
UseKlebsiella pneumoniae expressionExpressionBacterialMutationS8A, V144G, V146CAvailable SinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only