We narrowed to 13,357 results for: BASE
-
Plasmid#217012PurposeExpression of CDK7 in insect cellsDepositorInsertCDK7 (S164D, T170E)_del327-346 (CDK7 Human)
TagsTEV cleavable his tagExpressionInsectMutation(S164D, T170E)_del327-346Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pFastBac dual_Human full length CDK7(W132R, S164D, T170E)
Plasmid#217013PurposeExpression of CDK7 in insect cellsDepositorInsertCDK7(W132R, S164D, T170E) (CDK7 Human)
TagsTEV cleavable his tagExpressionInsectMutationCDK7(W132R, S164D, T170E)Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-30a (+)_CDK2-7 chimera (I10L,T14Q,V64I,K88E,K89V,D92K,Q131N)
Plasmid#217014PurposeExpression of CDK2-7 chimera in E.coliDepositorTagsC3 protease cleavable GST tagExpressionBacterialMutationCDK2 (I10L,T14Q,V64I,K88E,K89V,D92K,Q131N)Available SinceJuly 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pGM268
Plasmid#220181PurposeExpresses exogenous C-terminal mutant TTC1 (I271D) with an N-terminal sfGFP tagDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGM295
Plasmid#220183PurposeExpresses exogenous wild-type SEC61B with a C-terminal sfGFP tagDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET151-GyrB_A467
Plasmid#216234PurposeS. aureus USA300 GyrB mutant A467 residue codon-optimized for E. coliDepositorInsertDNA gyrase
Tags6xHisExpressionBacterialMutationChanged alanine 467 to valinePromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET151-GyrB_T522
Plasmid#216235PurposeS. aureus USA300 GyrB mutant T522 residue codon-optimized for E. coliDepositorInsertDNA gyrase
Tags6xHisExpressionBacterialMutationChanged threonine 522 to isoleucinePromoterT7Available SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EhT
Plasmid#215546PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived hygromycin-NLS-tdTomato selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
B2M-SDMutation-EPG
Plasmid#215545PurposeDonor plasmid to introduce splice donor mutation on the first intron of human B2M locus to mediate knock-outDepositorInsertB2M homologous recombination arms (Mutation on right HA) and EF1alpha-drived puromycin-GFP selection cassette (B2M Human)
UseCRISPRMutationThe second base of the first intron of B2M (From …Available SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGL3-MTS-G3635A-R16-Q2L7-T2176C-UGI-Puro
Plasmid#209648PurposeTo install m.G3635 mutation on mtDNADepositorInsertR16-Q2L7-T2176C
ExpressionMammalianAvailable SinceJan. 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-4300-L1-G1397N
Plasmid#210396PurposeTo correct m.A4300G mutation on mtDNADepositorInsert4300-L1-G1397N
ExpressionMammalianAvailable SinceDec. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
PB-CAG-4300-H2-G1397C
Plasmid#210395PurposeTo correct m.A4300G mutation on mtDNADepositorInsert4300-H2-G1397C
ExpressionMammalianAvailable SinceDec. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCAG.Myc-SARS2_3CL(C145A)
Plasmid#200121PurposeExpresses N-terminal Myc-tagged human codon optimyzed SARS-CoV-2 3CL C145A in mammalian cellsDepositorInsertSARS-CoV-2 3CL protease (ORF1ab SARS-CoV-2)
TagsMycExpressionMammalianMutationC145APromoterCAGAvailable SinceMay 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G1G2
Plasmid#188965PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA 1: atcggtcgcattgttttccactagg, sgRNA 2: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2
Plasmid#188964PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMM4_14L
Plasmid#183063PurposePlasmid expressing a biosensor for acetic acid and pHluorin: BM3R1-Haa1-mTurquoise2 under RET2p, mCherry under HREsYGP1p and sfpHluorin under TDH3p with flanks for genome integration into HO locusDepositorInsertsmCherry
sfpHluorin
BM3R1-HAA1-mTurquoise2
UseSynthetic BiologyTagsmCherry and mTurquoise2ExpressionYeastPromoterRET2, Synthetic promoter, and TDH3Available SinceSept. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCL8
Plasmid#176184PurposegRNA cloning cassette with RPR1p-tetO promoter and terminator RPT1t, RPR1p-tetO-GFP-scRNA-RPR1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMCL8_28bp
Plasmid#176185Purposeplasmid containing scaffold gRNA for Cas9 followed by a 28bp Csy4 recognition sequence, RPR1p-tetO-GFP-scRNA-28bpCsy4-RPR1tDepositorTypeEmpty backboneUseSynthetic BiologyAvailable SinceFeb. 4, 2022AvailabilityAcademic Institutions and Nonprofits only