We narrowed to 19,086 results for: sta
-
Plasmid#23774DepositorInsertTP53RK (TP53RK Human)
UseGateway CloningAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT59
Plasmid#223431PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT17
Plasmid#223389PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET15b-ACP (from S. aureus)
Plasmid#63686PurposeInducible expression of Acyl Carrier Protein (ACP) from S. aureusDepositorInsertACP
TagsHisExpressionBacterialMutationcodon optimizedPromoterT7Available sinceApril 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-iRFP670-24xMS2
Plasmid#238915PurposeContains miniCMV promoter expressing iRFP670 mRNA taged 24xMS2 motifDepositorInsertiRFP670-24xMS2
UseLentiviralExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TFORF0464
Plasmid#142633PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable sinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTrc-GWS1B
Plasmid#239582PurposeHigh copy vector for expression of GWS1B RubiscoDepositorInsertGWS1B Rubisco (6X his)
Tags6X histagExpressionBacterialMutationWild-typePromoterTrcAvailable sinceJuly 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGPTVII-SED1
Plasmid#232615PurposeSED1 biosensor for expression in Arabidopsis thalianaDepositorInsertSED1 Biosensor
ExpressionPlantPromoterpUBQ10Available sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mammalian_SaAID
Plasmid#188653PurposeExpresses SaAID in mammalian cellsDepositorPublicationInsertnSaCas9-AID-UGI
TagsUGIExpressionMammalianMutationD10A for SaCas9PromoterpCMVAvailable sinceNov. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
TR- ATG-HP-GFP
Plasmid#80592PurposeExpresses GFP with an Csy4 target hairpin inserted immediately following the start codon for Csy4-mediated regulation. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.DepositorInsertGFP
UseAAVExpressionMammalianMutationInserted 30 nt hairpin which is targeted by Csy4 …PromoterCBAAvailable sinceOct. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
EF2451_pET21a(+)
Plasmid#13840DepositorInsertPPAT
TagsHisExpressionBacterialAvailable sinceJune 29, 2007AvailabilityAcademic Institutions and Nonprofits only -
B108-Otx2-IRES-Cre
Plasmid#73993PurposeB108 enhancer of Blimp1 gene drives Otx2 (isoform b) and Cre expression.DepositorInsertB108-Otx2 (isoform b)-IRES-Cre (Otx2 Mouse)
ExpressionMammalianAvailable sinceJuly 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Dest47- WTN23C11orf83-GFP
Plasmid#65845PurposeMammalian expression of the wild type N terminal part (N23, transmembrane part of 23 aa) of C11orf83/UQCC3 fused to GFP protein (C-ter)DepositorInsertTransmembrane (23 AA) of UQCC3 (UQCC3 Human)
TagsGFPExpressionMammalianMutationWT TransmembraneAvailable sinceJuly 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
mTagBFP2-Dectin1A-C-10
Plasmid#55290PurposeLocalization: Membrane, Excitation: 399, Emission: 456DepositorAvailable sinceOct. 22, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
mTagBFP2-Cx32-7
Plasmid#55287PurposeLocalization: Gap Junctions, Excitation: 399, Emission: 456DepositorAvailable sinceOct. 10, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBEG R2-iHygro-L3 #BGV206
Plasmid#48985PurposeSupplies the selection marker (hygromycin resistance) and IRES with flanked by AttR2 and AttL3 sites for Gateway cloning recombination reaction. (This corresponds to a module 3 plasmid).DepositorInserthygromycin phosphotransferase
UseGateway CloningTagsIRES (weak)PromoternaAvailable sinceJune 16, 2014AvailabilityAcademic Institutions and Nonprofits only -
phpBCL2-FL(pA)
Plasmid#42593DepositorInserthairpin - BCL2 5'UTR - firefly luciferase
UseLuciferaseExpressionMammalianPromoterCMVAvailable sinceMarch 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-CD2
Plasmid#23590DepositorAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag2B Flag BimEL(TD)
Plasmid#23092DepositorInsertBim EL (TD) (Bcl2l11 Mouse)
TagsFlagExpressionMammalianMutationChanged Threonine 112 to AspartateAvailable sinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLPC TRF2 deltaM
Plasmid#18007DepositorAvailable sinceMay 29, 2008AvailabilityAcademic Institutions and Nonprofits only