We narrowed to 1,633 results for: PTS
-
Plasmid#195497PurposeFirefly luciferase promoter expression vector driven only by the promoter element of human lncRNA T-REX17DepositorInsertPromoter region of lncRNA T-REX17
Tagsluc2-hPESTExpressionMammalianAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
csd5_41-192/pET28b(+)
Plasmid#83296Purposecsd5, construct: 41-192, pET28b(+) N-tagDepositorInserthp1250
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-40Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
csd4_22-438/pET28b(+)
Plasmid#83295Purposecsd4, construct: 22-438, pET28b(+) N-tagDepositorInserthp1075
TagsHis tagExpressionBacterialMutationdeleted amino acid 1-21Available SinceNov. 3, 2016AvailabilityAcademic Institutions and Nonprofits only -
pUC18_BCR_GUSB_e19a2
Plasmid#190884Purposemolecular monitoring of atypical BCR::ABL1 fusion transcriptsDepositorUseCloned cdna transcripts for use in rt-qpcr bcr::a…Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC18_BCR_GUSB_e6a2
Plasmid#190882Purposemolecular monitoring of atypical BCR::ABL1 fusion transcripts (e6a2)DepositorUseCloned cdna transcripts for use in rt-qpcr bcr::a…Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC18_BCR_GUSB_e8a2
Plasmid#190883Purposemolecular monitoring of atypical BCR::ABL1 fusion transcriptsDepositorUseCloned cdna transcripts for use in rt-qpcr bcr::a…Available SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC18_BCR_GUSB_ABL1_e14a3
Plasmid#190885Purposemolecular monitoring of atypical BCR::ABL1 fusion transcriptsDepositorInsertsUseCloned cdna transcripts for use in rt-qpcr bcr::a…Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
TFORF3031
Plasmid#144507PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceAug. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pPSG830
Plasmid#158601PurposetNCS-ePTS1 (2micron)DepositorInsertpTDH3-tNCS-ePTS1
TagsePTS1ExpressionYeastAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
pJJB207
Plasmid#158599PurposeUbiY-Venus-ePTS1DepositorInsertUbiY-Venus-ePTS1
TagsUbi-Y and ePTS1ExpressionYeastAvailable SinceOct. 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
NK651
Plasmid#109107PurposeReporter gene expression in S. rosettaDepositorInsertPTSG_07215 deltaCC
UseChoanoflagellate expressionMutationDeletes C-terminal coiled-coil from PTSG_07215Available SinceJuly 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI152-pLenti-SiT-Cas12a
Plasmid#128405PurposeExpress both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseLentiviralExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCE048-SiT-Cas12a
Plasmid#128124PurposeExpress both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pG-HIV-LRT
Plasmid#104592PurposeStandard for qPCRDepositorInsertHIV-1 late reverse transcripts
UseCloning vectorAvailable SinceJan. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI108-SiT-Cas12a-[Cond]
Plasmid#128407PurposeConditionally express both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCI118-SiT-Cas12a-[Ind]
Plasmid#128406PurposeInducible expression of both AsCas12a and CRISPR arrays on single transcriptsDepositorInsertAsCas12a-Triplex
UseAAVExpressionMammalianAvailable SinceOct. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDY380
Plasmid#182962PurposeAmp-resistant, low copy (p15A ori), E. coli 5'ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY390
Plasmid#182963PurposeAmp-resistant, low copy (p15A ori), E. coli ptsI transcriptionally fused with GFP.DepositorInsertptsI
UseSynthetic BiologyTagsGFPAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY279
Plasmid#182959PurposeStr resistant,CoE1* ori. CRISPR/Cas9 gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations in ptsI. (for 1st round editing)DepositorInsertgRNA (ttcaggcattttagcatccc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDY281
Plasmid#182960PurposeAmp resistant, CoE1* ori. CRISPR/Cas9 induced by AHTc, gRNA under constitutive J23119 promoter. gRNA targeting E. coli ptsI codon 2~9. HRT has synonymous mutations of ptsI. (for 2nd round editing)DepositorInsertgRNA (acctggtgaagccaatattc), homologous repair template for ptsI
UseSynthetic BiologyExpressionBacterialAvailable SinceJan. 29, 2024AvailabilityAcademic Institutions and Nonprofits only