We narrowed to 12,184 results for: ARIA
-
Plasmid#181701PurposeExpresses SARS-CoV-2 RBD domain from the B.1.1.529 (Omicron) variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-B.1.1.529 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339D, S371L, S373P, S375F, K417N, N440K, G446S, …Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-NTD-B.1.1.529-AVI
Plasmid#181698PurposeExpresses SARS-CoV-2 NTD domain from the B.1.1.529 (Omicron) variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-NTD-B.1.1.529 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationA67V, ∆H69, ∆V70, T95I, G142D, ∆V143, ∆Y144, ∆Y14…Available SinceMarch 2, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V3-rCD20-BSD
Plasmid#209754PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 3) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1AUC-DelStem-CD20-Puro
Plasmid#209758PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1; variant 1 mRNA isoform with mutations to disrupt the uORFs and the stem-loop within the 5'-UTR.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationMutations to disrupt the uORFs and the stem-loop …Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-XBB-AVI
Plasmid#196619PurposeExpresses SARS-CoV-2 RBD protein from the XBB variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-XBB
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339H, R346T, L368I, S371F, S373P, S375F, T376A, …Available SinceMarch 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-BQ.1.1-AVI
Plasmid#196618PurposeExpresses SARS-CoV-2 RBD protein from the BQ.1.1 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-BQ.1.1
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339D, R346T, S371F, S373P, S375F, T376A, D405N, …Available SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-RBD-SD1-BA.2-AVI
Plasmid#184534PurposeExpresses SARS-CoV-2 RBD-SD1 domain from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-RBD-SD1-BA.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationG339D, S371F, S373P, S375F, T376A, D405N, R408S, …Available SinceJune 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVRC8400-SARS-CoV-2-S2P-BA.2-AVI
Plasmid#184531PurposeExpresses SARS-CoV-2 S2P protein from the BA.2 variant with single chain Fc, HRV3C protease cleavage site, and AVI tagDepositorInsertSARS-CoV-2-S2P-BA.2 (S )
TagsAVI, HRV3C, and scFcExpressionMammalianMutationT19I, L24-, P25-, P26-, A27S, G142D, V213G, G339D…Available SinceMay 10, 2022AvailabilityAcademic Institutions and Nonprofits only