We narrowed to 15,447 results for: grn
-
Plasmid#183300PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH1 geneDepositorPublicationInsertIDH1
UseLentiviralAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_HDAC2
Plasmid#183298PurposeAll-in-One CRISPRko system with a guide RNA that targets HDAC2 geneDepositorPublicationInsertHDAC2
UseLentiviralAvailable sinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti Cas9/SB100
Plasmid#155294PurposeLentiviral expression of Cas9 and SB100DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSB100X-P2A-spCas9
ExpressionMammalianAvailable sinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLmoCascade-IL1RNcrRNA
Plasmid#126487PurposeEncodes L.monocytogenes CRISPR Type I-B crRNA targeting IL1RNDepositorInsertLmo IL1RN cr03
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
Geph CR shRNA
Plasmid#121068PurposeshRNA targeting the coding region of the gephyrin mRNADepositorInsertGPHN shRNA (Gphn Rat)
UseRNAiAvailable sinceApril 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCD296.7
Plasmid#113320PurposedCas9, MCP-TetD, J107 scRNA.b1DepositorInsertdCas9, MCP-TetD, J107 scRNA.b1_MS2
UseCRISPRExpressionBacterialAvailable sinceAug. 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000297275
Plasmid#78152PurposeshCDK4 targeting 3UTRDepositorAvailable sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMZ285
Plasmid#52226PurposeExpression of sgRNA precursor targeted against ade6M210DepositorInsertrrk1-sgRNA
UseCRISPRExpressionYeastPromoterrrk1Available sinceOct. 29, 2014AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT05
Plasmid#223377PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pBB75-ncRNA
Plasmid#194087PurposeExpresses Ec86 ncRNA in Escherichia coliDepositorInsertEc86 ncRNA
PromoterT7Available sinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
MTK234_033
Plasmid#123996PurposeEncodes the spCas9 sgRNA1 hAAVS1 (site 2) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA2 -hAAVS1
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
MTK234_034
Plasmid#123997PurposeEncodes the spCas9 sgRNA1 hAAVS1 (site 3) gRNA expression cassette as a type 234 part to be used in the MTK systemDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsgRNA3 -hAAVS1
ExpressionMammalianAvailable sinceDec. 13, 2019AvailabilityAcademic Institutions and Nonprofits only -
Guide-Generating Vector
Plasmid#125752PurposeGuide-Generating Vector for creating the Cys4-guide-scaffold structure in the first round of assemblyDepositorInsertCys4-GFPdropout-SpCas9scaffold
UseSynthetic BiologyAvailable sinceJuly 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pJC109.1-spp-12
Plasmid#26513DepositorPublicationInsertspp-12
UseRNAiAvailable sinceOct. 29, 2010AvailabilityAcademic Institutions and Nonprofits only -
enDelIscB
Plasmid#247329PurposeVector encoding human codon-optimized engineered DelIscB driven by CAG promoter, optimized sgRNA (sgRNA-V5) driven by hU6, and mCherry driven by CMV promoterDepositorInsertpCAG_enDelIscB_npNLS_polyA_pU6_sgRNA_V5-BsaI_pCMV_mCherry
ExpressionMammalianAvailable sinceJan. 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-shControl-EGFP
Plasmid#227685PurposeExpresses EGFP and scramble of shRNA targeting Atg7DepositorInsertscrambled shRNA control
ExpressionMammalianAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shATF4 #2
Plasmid#242703PurposeshRNA knockdown human ATF4 geneDepositorInsertATF4 (ATF4 Human)
UseLentiviralAvailable sinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT07
Plasmid#223379PurposeT-DNA vector for SpRY mediated mutagenesis for dicot plants; NG or NA PAM preference; SpRY was driven by AtUBQ10 and the sgRNA was driven by AtU3 promoter; Hygromycin for plants selection.DepositorInsertAtUBQ10-SpRY-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMS77
Plasmid#215681PurposeCas9 + guide plasmid targeting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable sinceMarch 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAbaMCi-GFP-gfp_pJMP2768
Plasmid#208889PurposeAcinetobacter baumannii CRISPRi test plasmid (GFP, gfp-targeting gRNA).DepositorInsertdCas9, sgRNA expression cassette, sfGFP
ExpressionBacterialAvailable sinceDec. 21, 2023AvailabilityAcademic Institutions and Nonprofits only