We narrowed to 13,472 results for: sequence
-
Plasmid#72132PurposeExpresses the extracellular region of the PlexinD1 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceMarch 2, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA3-GFP-LpIA(wild-type)
Plasmid#61821PurposeEncodes a wild-type sequence of LplA and serves as the negative control for resorufin labelingDepositorInsertE. coli lipoic acid ligase
Tags6XHis, EGFP, and FlagExpressionMammalianPromoterCMVAvailable SinceAug. 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-GalNAc-T2-GFP-ESCargo(FTV)
Plasmid#140163PurposeExpresses a regulatable secretory cargo for mammalian cells and a Golgi markerDepositorInsertGalNAc-T2-msGFP2 and piGH-FTVNTT-DsRed-Express2-FKBP(LV)(C22V) (GALNT2 Human, Synthetic)
TagsER signal sequence (MGWSCIILFLVATATGAHS) (N termi…ExpressionMammalianPromoterEF-1aAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-iGECI-NES
Plasmid#160424PurposeAAV plasmid for CaMKII-driven expression of a genetically-encoded calcium indicator iGECI with a nuclear export signal sequenceDepositorInsertiGECI-NES
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceJan. 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a-Nlux
Plasmid#176239PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-cmyc-natT1R2
Plasmid#113946Purposemammalian expression plasmid for c-myc-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pTT3 Flrt1-myc
Plasmid#72191PurposeExpress full-length Flrt1 with a C-terminal myc tagDepositorAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
MmEos3.2
Plasmid#203754PurposeEncodes the membrane anchor of Src including the first 15 resideues of the N terminus, with 1 myristoylation and short polybasic sequence, with mEos3.2 fused to the C terminus. Used as a fluorescent plasma membrane probe.DepositorAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-FLAG-GRM3-VN
Plasmid#98965PurposeFLAG-tagged human mGluR3 fused to N-terminus of split VenusDepositorInsertGRM3 (GRM3 Human)
TagsFLAG (dykddddk) epitope tag, Signal/leader sequen…ExpressionMammalianMutationFull-length, wildtypePromoterCMVAvailable SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
MCUabaa-Flag-PLYS1
Plasmid#236786PurposeMCU-MCUB fusion in abaa pattern. Only the initial MCU has a mitochondrial targeting sequence.DepositorUseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
MCUabab-Flag-pLYS1
Plasmid#236788PurposeMCU-MCUB fusion in abab pattern. Only the initial MCU has a mitochondrial targeting sequence.DepositorUseLentiviralTagsFLAGExpressionMammalianPromoterCMVAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG876 pDisplay-pFAST
Plasmid#172868Purposeexpresses pFAST at the surface of mammalian cellsDepositorInsertpFAST-PDGFR
TagsIgK leader sequence (N terminal on insert) and My…ExpressionMammalianPromoterCMVAvailable SinceFeb. 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCDH-EMTB-TurboID-V5-puro
Plasmid#190741PurposeA lentiviral plasmid encoding EMTB fusion to V5-tagged TurboID on microtubules (EMTB as the microtubule-targeting tag)DepositorInsertEMTB-TurboID-V5 (RPS14 Human, EMTB is human ensconsin; TurboID is engineered BirA from E.coli)
UseLentiviralTagsMycExpressionMammalianMutationMicrotubule binding-domain of ensconsin (amino ac…PromoterCMVAvailable SinceFeb. 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
Chicken Mermaid S188
Plasmid#53617PurposeGenetically encoded voltage sensor based on mUKG-mKOk FRET pairDepositorInsertChicken Mermaid S188
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 18, 2014AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(L)-AP-His
Plasmid#72039PurposeExpresses the extracellular region of the Sema6B protein (entire extracellular domain; ie, long), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTet-GLI2shR
Plasmid#136691PurposeInducible Gli2 shRNA lentiviral plasmid (target sequence: human GLI2 5′CCGGCCTGGCATGACTACCACTATGCTCGAGCATAGTGGTAGTCATGCCAGGTTTTTG 3′)DepositorInsertshRNA_humanGli2 (GLI2 Human)
UseLentiviralAvailable SinceJune 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
TrHKI-pGFPN3
Plasmid#21918DepositorInsertTruncated human HKI (lacking exon 1 sequence that encodes for the mitochondrial binding domain) in pGFP-N3 plasmid (HK1 Human)
TagsGFPExpressionMammalianMutationThis is the truncated human HKI cDNA (lacking exo…Available SinceOct. 1, 2009AvailabilityAcademic Institutions and Nonprofits only