We narrowed to 20,807 results for: ren
-
Plasmid#143038PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pEF1a_ TET1 CXXC only
Plasmid#124084PurposeExpression of CXXC domain only form of TET1DepositorAvailable SinceApril 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
TFORF2085
Plasmid#141914PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.24-Cd36-enhancer5
Plasmid#138577PurposeFirefly luciferase enhancer reporter fused with 1.5~2 kb fragments of mouse Cd36 enhancers at Chr5:17893352_17894696DepositorAvailable SinceMarch 26, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS1983
Plasmid#49114PurposeAAV plasmid with PITX3 (Ple253) promoter driving expression of iCre.DepositorInsertssAAV-Ple253-iCre
UseAAVExpressionMammalianPromoterPITX3Available SinceMay 10, 2016AvailabilityIndustry, Academic Institutions, and Nonprofits -
sTR056
Plasmid#177369PurposeToehold switch, with an unpaired toehold region at the 5′-end that interacts with the trigger RNA (sTR060, Addgene plasmid # 177370) to unfold the switch.DepositorInsertsfGFP
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
sTR060
Plasmid#177370PurposeTrigger RNA (GCAGGGATAAACGAGATAGATAAGATAAGA) that pairs with the toehold region in sTR056 (Addgene plasmid #177369) to restore translational activity.DepositorInsertTrigger RNA
UseSynthetic Biology; Cell-free protein synthesisAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
TFORF0849
Plasmid#141733PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
p13xLexAOP2-IVS-Syn21-Voltron-p10
Plasmid#119042PurposeLexAop2-driven expression of Voltron in DrosophilaDepositorInsertVoltron
ExpressionInsectPromoterhsp70Available SinceDec. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF3548
Plasmid#145024PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX p85b(C)-SH2
Plasmid#46466DepositorInsertp85b(C) (PIK3R2 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 610-728PromoterTacAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B
Plasmid#108883PurposeMultisite gateway vector for 5' tagging with the human histone H2B sequence (for nuclear localisation)DepositorInsertH2B (human amino acid sequence but different codon usage) (H2BC21 Synthetic, Human)
UseMultisite gatewayMutationhuman amino acid sequence but different codon usa…Available SinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
TFORF3147
Plasmid#144623PurposeLentiviral vector for overexpressing transcription factor ORFs with unique 24-bp barcodes. Barcodes facilitate identification of transcription factors in pooled screens.DepositorAvailable SinceJan. 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGW05 AAV-CRISPRa base vector pAAV-OE_U6-Lib(MS2)-EF1a-MPH-sPA
Plasmid#192159PurposeAAV-CRISPRa base vectorDepositorTypeEmpty backboneUseAAVMutationNAAvailable SinceNov. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGEX tensin-SH2
Plasmid#46525DepositorInserttensin (TNS1 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 1451-1588PromoterTacAvailable SinceJuly 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
lenti-sgRNA(MS2)_zeo_hPDX1_promoter_guide1
Plasmid#176838PurposeTo induce human PDX1 expression by recruiting SAM complex to PDX1 promoterDepositorInsertsgPDX1
ExpressionMammalianPromoterU6Available SinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pGEX Socs4-SH2
Plasmid#46507DepositorInsertSocs4 (SOCS6 Human)
TagsGST and PreScissionExpressionBacterialMutationcontains amino acids 376-498PromoterTacAvailable SinceJuly 12, 2013AvailabilityAcademic Institutions and Nonprofits only -
pEN_TGmiR_Gb2-K
Plasmid#25766PurposeEntry vector withTRE promoter driving mouse G beta 2 miR30-based shRNA with GFP coexpression.DepositorAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1a-EGFP-TA Bik-IRES-Puromycin
Plasmid#133026PurposeExpresses EGFP-tagged tail anchor sequence of BikDepositorInsertBcl-2-interacting killer (BIK Human)
UseLentiviralTagsEGFPExpressionMammalianMutationdeleted amino acids 1-110PromoterHuman elongation factor 1 alphaAvailable SinceFeb. 7, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEMS2049
Plasmid#79657PurposessAAV genome with Ple260 (PAX6 MiniPromoter) driving an emerald GFP (EmGFP) reporter. Contains WPREDepositorInsertssAAV Ple260-EmGFP WPRE
UseAAVPromoterPAX6 Retinal EnhancerAvailable SinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only