We narrowed to 13,472 results for: sequence
-
Plasmid#113960Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 extracellular domain with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-563PromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn1 CaRhGC wt T2A tDimer
Plasmid#101720Purposehumanized, Neuron-specific promoter driven expression of the rhodopsin guanylyl cyclase from Catenaria anguillulae with a neuron-specific promoter. Useful for raising intracellular cAMP close to the mDepositorInsertsCatRhGC
red fluorescent protein
UseAAVExpressionMammalianPromoterhSyn1 and ribosomal skip sequence T2AAvailable SinceJan. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGEX4T1-ISG15 C78SN13Y
Plasmid#165106Purposebacterial expressio of a GST fusion of Human ISG15 C78SN13YDepositorInsertISG15 (ISG15 Human)
TagsGST from plasmid.ExpressionBacterialMutationC78SN13Y; The sequence of ISG15-C78S/N13Y contai…Available SinceMarch 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLVX-5'-aptamer-tagged-SVA-lncRNA-AK057321-mcherry
Plasmid#202818PurposeLentiviral vector to express 5'-aptamer tagged SVA-lncRNA AK057321 with CMV for mcherry expressionDepositorInsertSVA-lncRNA AK057321
UseLentiviralExpressionMammalianMutationaddition of a dual aptamer RNA tag 5' to the…PromoterU6Available SinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMXs_MCART1
Plasmid#133253PurposeExpress untagged MCART1 in mammalian cellsDepositorInsertMCART1 (SLC25A51 Human)
UseRetroviralExpressionMammalianMutationcodon-optimized for expression in human cells and…Available SinceSept. 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCMV-BE3-FNLS(RA)
Plasmid#112671PurposeCMV expression vector for BE3-FNLS construct (codon optimized)DepositorInsertBE3-FNLS
Tags3x FLAGExpressionMammalianMutationNLS sequence at the N-terminus and D10APromoterCMVAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSCGB3A2_HL-P2A-TagBFP-PGK-NeoR-SCGB3A2_HR
Plasmid#126697Purposedonor vector for targeting a 2A peptide followed by blue fluorescent reporter to the human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertTagBFP
ExpressionMammalianAvailable SinceJuly 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLEX Myc-HA
Plasmid#229499PurposeFor lentiviral expression of Myc coding sequence with an HA tag.DepositorInsertMYC
UseLentiviralTagsHAExpressionMammalianPromoterCMVAvailable SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
hCXCR4-mTFP1
Plasmid#110195PurposeEncodes for human CXCR4 coding sequence tagged with the mTFP1 FPDepositorAvailable SinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-SCGB3A2_gRNA1-SpCas9-T2A-GFP
Plasmid#126698Purposeto express Cas9 from S. pyogenes with 2A-EGFP and sgRNA targeting human SCGB3A2 locus at the end of the endogenous coding sequenceDepositorInsertsgRNA targeting human SCGB3A2 locus
ExpressionMammalianPromoterHuman U6Available SinceJune 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
Cer(1-158)-RGS7
Plasmid#55760PurposeAn amino-terminal mCerulean fragment was fused to RGS7. When co-expressed with a carboxyl terminal fragment of CFP fused to Gbeta-5, a fluorescent signal is produced.DepositorInsertmCer(1-158)-RGS7 (RGS7 Human, Aequorea victoria)
TagsCer(1-158) was fused to the amino terminus of RGS…ExpressionMammalianMutationRGS7 was amplified via PCR, which added an N-term…PromoterCMVAvailable SinceJuly 30, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSems leader-ALFA-mXFP-TpoR
Plasmid#222945PurposeExpression of TPOR with ALFAtag and monomeric XFP in mammalian cellsDepositorInsertThrombopoietin receptor (26-635) (MPL Human)
TagsALFAtag, Ig k-chain leader sequence, and mXFPExpressionMammalianMutationmXFP: tryptophan 66 to phenylalanine, TPOR: Signa…PromoterCMVAvailable SinceJan. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRII-Topo Vglut2 in situ probe
Plasmid#45639DepositorInsertVglut2 in situ probe (Slc17a6 Mouse)
UseIn situMutationfragment contains nt 2477-2993 of slc17a6 (Vglut2…Available SinceJune 3, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC48
Plasmid#62336PurposesgRNA + 1x COM with COM-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x COM binding module
COM-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2
Plasmid#176252PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene of N. oceanica IMET1 separated by fullDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCol1a1-frt (FVB)
Plasmid#63575PurposeTargeting vector for the Col1a1 locus that contains a Neo resistance cassette flanked by FRT sites, followed by an ATG-less Hygromycine resistance gene. The homology arms match the sequence of FVB.DepositorInsertCol1A-frt-hygro-pA
UseMouse Targeting; Frt/flpeExpressionBacterial and MammalianPromoterNoneAvailable SinceMarch 25, 2015AvailabilityAcademic Institutions and Nonprofits only -
plko-shmfn2-mfn2-Rescue
Plasmid#160655Purpose"Rescue mfn2 expression by adding the guide-resistant-mutant mfn2 sequence"DepositorAvailable SinceDec. 15, 2020AvailabilityAcademic Institutions and Nonprofits only -
proE-cad670-Luc-mEbox
Plasmid#42084DepositorInsertE-cadherin (CDH1 Human)
UseLuciferaseExpressionMammalianMutationcontains E-cadherin promoter region from -670 to …PromoterE-cadherinAvailable SinceApril 10, 2013AvailabilityAcademic Institutions and Nonprofits only -
Flrt3-Fc-His
Plasmid#72075PurposeExpresses the extracellular region of the FLRT3 protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 12, 2016AvailabilityAcademic Institutions and Nonprofits only