We narrowed to 81,790 results for: MYC;
-
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRS313_MSN5-LY00018
Plasmid#232903PurposePlasmid carrying MSN5 from LY00018 (YJM975) with its native promoter and terminator.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-YFR054C
Plasmid#232900PurposePlasmid expressing Cas9 and gRNA GCTCAAAGAAACAATTAGAG which targets the YFR054C gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SRP14
Plasmid#232896PurposePlasmid expressing Cas9 and gRNA GAAAACAAAATGCTCAACAG which targets the SRP14 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-TLG1
Plasmid#232897PurposePlasmid expressing Cas9 and gRNA GATGAAAACGAAGACGTGAG which targets the TLG1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VHT1
Plasmid#232898PurposePlasmid expressing Cas9 and gRNA TGCGGCCACACTGAAATACG which targets the VHT1 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA3-Sec7-mEYFP
Plasmid#218968PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mEYFPDepositorAvailable SinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUSE-URA-Sec7-mGold
Plasmid#218967PurposeGene replacement plasmid to label S. cerevisiae Sec7 with mGoldDepositorAvailable SinceSept. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
YIplac211-Kar2-moxGFP2-HDEL
Plasmid#218970PurposeGene replacement plasmid to label S. cerevisiae Kar2 with moxGFP2DepositorAvailable SinceSept. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pXR004_puroR
Plasmid#219820PurposehU6-driven pre-gRNA plasmid for CasRx applications with puromycin resistance. 5' processed DR followed by BbsI sites for guide cloning (Adapted from plasmid #10954)DepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterhU6Available SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
L1T15 - T2PsB (mtagBFP2, mCherry, NeonGreen)
Plasmid#219689PurposeLevel 1 preswitched History-dependent target without promoter, switch by Bxb1, output: mCherry then NeonGreen (for transformation, Kan plant resistance, Kan bacteria resistance).DepositorInsertT2PsB (mtagBFP2, mCherry, NeonGreen)
ExpressionPlantAvailable SinceJuly 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
KBB96
Plasmid#185113PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion truncated so only one FXFG repeat remainsDepositorInsertNUP1
TagsGSTExpressionBacterialMutationLast FXFG domain of Nup1Available SinceJuly 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
KBB109
Plasmid#185066PurposeBacterial expression of C-terminus of NUP1 nucleoporin as GST-Nup1-C fusion truncated after NsiI restriction siteDepositorInsertNUP1
TagsGSTExpressionBacterialMutationNup1 C-terminal region, truncated at NsiI restric…Available SinceJuly 19, 2022AvailabilityAcademic Institutions and Nonprofits only