We narrowed to 29,139 results for: Tat
-
Plasmid#99853PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13V/sgKras/Cre
Plasmid#99860PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13V mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
MB 38t3 thsS(t3)R-bARGSer
Plasmid#232468PurposeOptimized thiosulfate sensor with acoustic reporter genes (bARGSer)DepositorInsertsthsS(t3)
thsR
PphsA342
bARGSer
AxeTxe
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23104 (ttgacagctagctcagtcctaggtattgtgctagc), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-Cstem(7A)-Tac(5A)
Plasmid#162499PurposeExpresses GFP tagged Tac mutant in mammalian cells. The five O-glycosylation sites in the stem region are mutated, and the stem region of CD8a with mutations is inserted between GFP and Tac(5A).DepositorInsertTagsGFPExpressionMammalianMutationThe five theronine and two serine residues are mu…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13S/sgKras/Cre
Plasmid#99859PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13S mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13A/sgKras/Cre
Plasmid#99855PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceMay 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
J23100_PheS*_codon
Plasmid#247070Purposeexpress codon optimized PheS* gene with constitutive promoter BBa_J23100DepositorInsertmutated (A294G) E.coli PheS of which codon is changed
ExpressionBacterialAvailable SinceMarch 6, 2026AvailabilityAcademic Institutions and Nonprofits only -
MTST5
Plasmid#86602PurposeCustom designed synthetic DNA fragment lacking homology to natural sequences for preparation of internal standards for RNA-seq in metatranscriptomics.DepositorInsertMTST5
UseInternal standard reverse transcriptionPromoterT7Available SinceSept. 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
MTST6
Plasmid#86603PurposeCustom designed synthetic DNA fragment lacking homology to natural sequences for preparation of internal standards for RNA-seq in metatranscriptomics.DepositorInsertMTST6
ExpressionBacterialPromoterT7Available SinceSept. 15, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
FB407
Plasmid#203628PurposePromoter of the elongation factor 1-alpha gene from P. digitatum (PDIG_59570).DepositorInsertPef1A
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBEL2511
Plasmid#195625PurposeComplementation of MlaA(WT)DepositorInsertMlaA
ExpressionBacterialAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
FB408
Plasmid#203629PurposePromoter of the ubiquitin ligase gene from P. digitatum (PDIG_07760).DepositorInsertP07760
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB359
Plasmid#203614Purpose5' upstream region of pyrG gene in P. digitatum.DepositorInsert5' upstream Pdig pyrG
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB361
Plasmid#203615Purpose3' downstream region of pyrG gene in P. digitatum.DepositorInsert3' downstream Pdig pyrG
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB372
Plasmid#203616PurposeAssembly for pyrG deletion in P. digitatum.DepositorInsertFB359+FB361
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
FB404
Plasmid#203625PurposePomoter of antifungal protein afpB gene from P. digitatum.DepositorInsertPafpB
UseSynthetic BiologyAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBEL2403
Plasmid#195642PurposeComplementation of MlaC(WT)DepositorInsertMlaC
ExpressionBacterialAvailable SinceMay 2, 2023AvailabilityAcademic Institutions and Nonprofits only -
RSRF-Luc-2mut
Plasmid#31819DepositorInsertMutant MEF2-dependent promoter (-307 to -242 of Nur77/NR4A1)
UseLuciferaseExpressionMammalianMutationtwo CTATATTTAG RSRF sites mutated to CGATATTTCGPromotermutated MEF2-dependent (-307 to -242 of Nur77/NR4…Available SinceAug. 29, 2011AvailabilityAcademic Institutions and Nonprofits only