We narrowed to 12,237 results for: nsf
-
Plasmid#208715PurposeExpresses the green 5-HT sensor GRAB_g5-HT2h in neurons in the presence of Cre recombinaseDepositorInsertGreen fluorescent 5-HT sensor GRAB_g5-HT2h
UseAAVPromoterhSynAvailable SinceOct. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
miR5 HsATP10B
Plasmid#204481Purposetransfer plasmid for lentiviral vector production with miR for Hs ATP10BDepositorAvailable SinceOct. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
CSII-TK-B4GALT3
Plasmid#203598PurposeLentiviral vector to express B4GALT3 in mammalian cellsDepositorInsertbeta-1,4-galactosyltransferase 3 (B4GALT3 Human)
UseLentiviralExpressionMammalianMutationWTPromoterTKAvailable SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
psicheck2-B4GALT3
Plasmid#203601PurposeReporter plasmid carrying B4GALT3 3'UTRDepositorInsertbeta-1,4-galactosyltransferase 3 (B4GALT3 Human)
UseLuciferaseExpressionMammalianMutationnt 1800-2330 3'UTRPromoterSV40Available SinceOct. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.23-Gja1prom
Plasmid#188114PurposeExpresses luciferase under control of Gja1 promoter in transfected cellsDepositorInsertGja1 promoter (Gja1 Mouse)
UseLuciferasePromoterGja1 endogenous promoter up to gene start codonAvailable SinceSept. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pET19-TdTdelta5cys
Plasmid#207465PurposeBacterial expression of Terminal deoxynucleotidyl transferase (TdT) surface-cysteine free variantDepositorInsertTdTdelta5cys (Dntt Mouse)
Tags10xHisExpressionBacterialMutationCys188Ala, Cys216Ser, Cys302Ala, Cys378Ala, and C…Available SinceSept. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-BR1-P2A-FusionRed
Plasmid#192819PurposeExpresses BR1 with FusionRed tag in mammalian cellsDepositorInsertBR1 (BRI1 Mustard Weed)
UseAAVTagsFusionRedExpressionMammalianPromoterchicken β-actin promoterAvailable SinceSept. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-RO1.7-Hsp90ab1-FLAG
Plasmid#206355PurposeAAV plasmid expressing FLAG-tagged HSP90AB1 in photoreceptorsDepositorAvailable SinceAug. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn1_AdoLightG
Plasmid#187465PurposeExpresses green adenosine indicator AdoLightG in neuronal cellsDepositorInsertAdoLightG
UseAAVTagsFlag tagPromoterhuman Synapsin-1Available SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform E (codon optimized)
Plasmid#199570PurposeStable and dox. inducible expression of Trim69 isoform E (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform E (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform D (codon optimized)
Plasmid#199569PurposeStable and dox. inducible expression of Trim69 isoform D (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform D (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRetroX-Tight-Pur-Trim69 isoform C (codon optimized)
Plasmid#199568PurposeStable and dox. inducible expression of Trim69 isoform C (codon optimized) after retroviral-mediated gene transferDepositorInsertTrim69 isoform C (codon optimized) (TRIM69 Human)
UseRetroviral; Allows for puromycin selectionTagsFlagMutationcodon optimizedAvailable SinceMay 5, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(103)-GFP
Plasmid#197890PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(553)-GFP
Plasmid#197888PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAGGS-Flex/3'USS(285)-GFP
Plasmid#197889PurposeCan be used to generate AAV virus that will express GFP in the presence of Cre including the shortage of a unilateral spacer sequence(USS)DepositorInsertGFP
UseAAVMutationN/APromoterCAGAvailable SinceMarch 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-intron-DIO-hfCas13d-pA
Plasmid#195866PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_ER
Plasmid#182818PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_ER
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_PM
Plasmid#182819PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_PM
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV9-hSyn-iEscSnFR_cyto
Plasmid#182820PurposeDevelop a family of genetically encoded fluorescent biosensors for nicotinic agonists, termed iDrugSnFRs, thus enabling optical subcellular pharmacokinetics for nicotinic agonistsDepositorInsertiEscSnFR_cyto
UseAAVPromoterhSynAvailable SinceJan. 18, 2023AvailabilityAcademic Institutions and Nonprofits only