We narrowed to 27,636 results for: GFP
-
Plasmid#229997PurposeExpresses anti-GFP PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG17-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable SinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pARNTL.1.0-gDNA
Plasmid#112480PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor ARNTLDepositorAvailable SinceDec. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJUNB.1.0-gDNA
Plasmid#112409PurposeCRISPR plasmid for expression of Cas9 and gRNA targeting human transcription factor JUNBDepositorAvailable SinceDec. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK2 (K57A)
Plasmid#197114PurposeExpression of kinase-deficient GFP-tagged TAOK2 (K57A) / PSK1 (K57A) in mammalian cellsDepositorInsertTAOK2 (K57A) (TAOK2 Human)
TagsGFPExpressionMammalianMutationChanged K 57 to APromoterCMVAvailable SinceMarch 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
LV TRE-GFP-TMD-DLL1
Plasmid#194936PurposeLV construct encoding GFP-TMD-DLL1 ligand under dox-inducible TRE promoter and containing a PGK-rtTA-M2-IRES-Puro regulator/resistance marker cassette.DepositorInserteGFP-(PDGFR)TMD-rDLL1 ICD (WT)
UseLentiviralAvailable SinceMarch 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-PI4KB
Plasmid#221759PurposeStable expression of GFP-PI4KB in mammalian cellsDepositorAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMRXIP-GFP-2xFYVE
Plasmid#221750PurposeStable expression of GFP-2xFYVE in mammalian cellsDepositorInserttandem HRS FYVE domain
UseRetroviralTagsGFPExpressionMammalianMutationtwo FYVE domains (amino acids 147-223), linked by…Available SinceAug. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSC101-GFPmut2-mScarlet-I
Plasmid#208183Purposemistranslation GFP and mScarlet-I positive controlDepositorInsertsGFPmut2
mScarlet-I
UseReporterExpressionBacterialPromoterPtet+dnaK P1Available SinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
CB6-GFP-TAOK1
Plasmid#197108PurposeExpression of GFP-tagged TAOK1 / PSK2 in mammalian cellsDepositorAvailable SinceMarch 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
H2B-2A-GFP-IRESpuro2
Plasmid#183746PurposeExpresses H2B-2A-GFPDepositorInsertH2B (H2BC16P Human)
TagsGFP with 2A protease cleavage site between H2B an…ExpressionBacterial and MammalianPromoterCMVAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
Avr2-GFP pZK538
Plasmid#118011Purposeexpresses Avr2-GFP (without signal peptide) and mCherry-HDEL. Used for visualization of cell-to-cell movement of Avr2. Avr2 can be replaced with gene of interest via HiFi DNA assembly cloning (NEB) .DepositorArticleInsertsdspAvr2
mCherry
TagsEGFP and HDELExpressionBacterial and PlantPromoter35SAvailable SinceAug. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKin1A
Plasmid#31607DepositorAvailable SinceOct. 4, 2011AvailabilityAcademic Institutions and Nonprofits only -
pB-Halo,IRES-eGFP
Plasmid#164519PurposeAll-in-One piggyBac transposon Gateway Destination vector for dox-inducible expression of N-terminal Halo tagged protein (inducible GFP and constitutive rtTA and neomycin resistance)DepositorTypeEmpty backboneExpressionMammalianAvailable SinceFeb. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLX-EF1a_NKX2-1_Short_V5-GFP
Plasmid#221497PurposeNKX2-1-GFP fusion protein lentiviral overexpression using an EF1a promoterDepositorAvailable SinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
peGFP C3-SPG20 8xV
Plasmid#218579PurposeExpresses GFP-tagged human SPG20 bulky hydrophobic amino acid mutant in mammalian cellsDepositorInsertSPG20 (SPART Human)
TagseGFPExpressionMammalianMutationchanged Tryptophan 419, Leucine 438, Isoleucine 4…PromoterCMVAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHCKan-yibDp2-GFPuv
Plasmid#139083PurposeLow phosphate inducible promoter yibDp2 for GFP expressionDepositorInsertyibDp2-GFPuv
ExpressionBacterialAvailable SinceSept. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
GFP-mROCK1-delta7
Plasmid#101295PurposeMammalian expression of Rock1-GFP for the study of localisation signaling.DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
TRUPATH Triple Gaq
Plasmid#196058PurposeEncodes a G alpha subunit (GNAQ) with RLuc8, a G gamma subunit (GNG9) with GFP2 and a G beta subunit (GNB3) as optimal components of a BRET2 biosensor for studying heterotrimeric G proteinsDepositorUseLuciferaseTagsGFP2 and GSAG linkerExpressionMammalianMutationRLuc8 and flanking SGGGGS linkers have been inser…PromoterCMVAvailable SinceFeb. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDECKO_GFP
Plasmid#141210Purposeempty GFP vector for cloning sgRNA or pgRNAsDepositorTypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only