We narrowed to 27,811 results for: GFP
-
Plasmid#248596PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only
-
pRP[Exp]-CAG>dme_eIF1[NM_139535.4](ns):3xGGGGS:EGFP
Plasmid#248597PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_eIF2gamma[NM_001275658.1](ns):3xGGGGS:EGFP
Plasmid#248598PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_eIF3k[NM_137760.3](ns):3xGGGGS:EGFP
Plasmid#248599PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_eIF4E1[NM_001274698.1](ns):3xGGGGS:EGFP
Plasmid#248600PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_eIF6[NM_145105.3](ns):3xGGGGS:EGFP
Plasmid#248601PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_emb[NM_164818.2](ns):3xGGGGS:EGFP
Plasmid#248602PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_Ggamma30A[NM_164852.3](ns):3xGGGGS:EGFP
Plasmid#248604PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_janA[NM_176585.2](ns):3xGGGGS:EGFP
Plasmid#248605PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
pRP[Exp]-CAG>dme_mEFG1[NM_135261.2](ns):3xGGGGS:EGFP
Plasmid#248606PurposeC-terminal GFP tag for GOIDepositorAvailable sinceAug. 28, 2026AvailabilityAcademic Institutions and Nonprofits only -
Unc104_K560GFP
Plasmid#129773PurposeExpresses worm Kinesin-3 Unc104 head and neck linker, dimerized through kinesin-1 neck-coil and coil-1 to 560 and GFP taggedDepositorInsertUnc104 (unc-104 Nematode)
TagsGFP and His6ExpressionBacterialMutationTruncation at 361, fused to kinesin-1 starting Al…Available sinceNov. 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
rAAV-CAG::FLEX-rev:: hM4D-2a-GFP (AAV1)
Viral prep#52536-AAV1PurposeReady-to-use AAV1 particles produced from rAAV-CAG::FLEX-rev:: hM4D-2a-GFP (#52536). In addition to the viral particles, you will also receive purified rAAV-CAG::FLEX-rev:: hM4D-2a-GFP plasmid DNA. CAG driven, Cre-dependent expression of hM4D and GFP. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable sinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
Antibody#192039-rAbPurposeAnti-Ankyrin-G (Human) recombinant mouse monoclonal antibodyDepositorRecommended applicationsImmunocytochemistry and ImmunohistochemistryReactivityHuman, Mouse, and RatSource speciesMouseIsotypeIgG2aTrial sizeAvailable to purchaseAvailable sinceFeb. 24, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits
-
CAG-loxP-3xpA-H2BsfGFP-tdTomato - T2A APGST -XE
Plasmid#113839PurposeHistone H2B-superfolder GFP and tdTomato linked by T2A (APGST linker -XE)DepositorInsertH2B-sfGFP-T2A-tdTomato
ExpressionMammalianAvailable sinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-anti-GFP(LaG17) PAGER(TF)
Plasmid#229997PurposeExpresses anti-GFP PAGER(TF) (high reversibility) in mammalian cells; used with NanoLuc-Arrestin-TEVp (Addgene #125228) and UAS-Firefly Luciferase reporter (Addgene #104840)DepositorInsertIL2SP-Aro6-LaG17-TEVcs-ALFA-KORD(RAA)-LOV-TEVcs-Gal4
UseAAVExpressionMammalianMutationV360A/R361A on KORDPromoterCMVAvailable sinceJan. 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5 FRT TO GFP hBub1 K821R
Plasmid#59813PurposeAllows the integration of GFP hBub1 K821R in the genome and Tet-inducible expression.DepositorInsertBub1 (BUB1 Human)
TagsEmGFPExpressionMammalianMutationK821RPromoterhybrid human cytomegalovirus (CMV)/TetO2 promoterAvailable sinceFeb. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pAP05
Plasmid#186261PurposesfGFP under light light responsive PEL222 promoter and EL222 under constitutively active BBa_J2305 promoterDepositorInsertsExpressionBacterialPromoterBBa_23105 (GGCTAGCTCAGTCCTAGGTACTATGCTAGC) and PE…Available sinceSept. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
cTRE-GFP-miR30_shRen
Plasmid#135666PurposeIntroduce Dox-inducible (TRE promoter) GFP cDNA plus miR30-embedded shRenilla into (ES) cells by recombination-mediated cassette exchangeDepositorInsertshRenilla
UseMouse TargetingAvailable sinceJan. 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pFastBac_HT_B_6xHis-TEV-GFP-NBR1
Plasmid#190928PurposePlasmid for the expression and purification of GFP labelled NBR1. Internal reference: SMC 914DepositorAvailable sinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-GFP-LC3-mRuby3
Plasmid#184898PurposeStable expression of GFP-LC3-mRuby3 in mammalian cells to measure autophagic fluxDepositorInsertLC3B
TagsEGFP and mRuby3ExpressionMammalianAvailable sinceJune 13, 2022AvailabilityAcademic Institutions and Nonprofits only