We narrowed to 17,560 results for: POR
-
Plasmid#154023PurposeBichromatic Fluorescent Splicing Reporter Minigene for Wild-Type BAP1 Exon 7DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianAvailable SinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem(5A)-GFP
Plasmid#162504PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One wildtype Tac stem region is inserted within ST and the other mutated Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
ST-2xTstem-GFP
Plasmid#162503PurposeExpresses a ST6GAL1 mutant with a GFP tag in its C-terminus in mammalian cells. One Tac stem region is inserted within ST and the other Tac stem region is inserted between ST and GFP.DepositorTagsGFPExpressionMammalianMutationOne Tac stem region is inserted within ST6Gal1 an…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221-TUSC3
Plasmid#132304PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertTUSC3 (TUSC3 Human)
ExpressionMammalianAvailable SinceNov. 11, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCI-TPI_WT-TNFalpha_3UTR-xrRNA-4H
Plasmid#108374PurposeExpresses wild type TPI reporter; contains partial TNFalpha 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertExpressionMammalianPromoterCMVAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDONOR-PARK6e5-I368N
Plasmid#86154PurposeDonor plasmid for PARK6 exon5 I368N sequence. Also contains TagBFP and dTomatoDepositorInsertPINK1 exon 5 homology arms (PINK1 Human)
ExpressionBacterial and MammalianAvailable SinceJune 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCI-TPI_WT-RAB7A_3UTR-xrRNA-4H
Plasmid#108372PurposeExpresses wild type TPI reporter; contains partial RAB7A control 3' UTR; enables detection of 5'-3' decay intermediates (xrFrag) and allows detection via northern blot (4H binding sites)DepositorInsertExpressionMammalianPromoterCMVAvailable SinceMay 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLuc-Optop38i-dsm
Plasmid#89748PurposeExpression of light-regulated p38 inhibitor, firefly luciferase-fused, dark-state mutant photosensor (AsLov2Ja.C450A), inhibitor MK3BD3-13FDepositorInsertOptop38i dark-state mutant
UseLuciferaseTagsFirefly luciferaseExpressionMammalianMutationC450A mutation of AsLov2JalphaPromoterCMVAvailable SinceAug. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_R (OZ604)
Plasmid#35244DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 15, 2012AvailabilityAcademic Institutions and Nonprofits only -
si:ch211-221n23.1_L (OZ603)
Plasmid#35243DepositorInsertZinc finger array targeting si:ch211-221n23.1 (si:ch211-221n23.1 Zebrafish)
UseZebrafish targetingAvailable SinceMarch 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
pEMS1486
Plasmid#29237PurposePleiades (Ple) MiniPromoter expression pattern described in de Leeuw et al., MTM, 2014 (PMID: 24761428).DepositorInsertPle16 (C8orf46 Human)
UsePleiades promoter project [sic, pleaides plieades]TagsIntron-LacZ-NLSAvailable SinceNov. 7, 2011AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLenti CMV Hygro DHFR.dn-cHSF1
Plasmid#134731PurposeLentiviral expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domainDepositorInsertDHFR.dn-cHSF1 (HSF1 Human)
UseLentiviralTagsDHFRExpressionMammalianMutationDeletion of amino acids 186-202, 379−529PromoterCMVAvailabilityAcademic Institutions and Nonprofits only -
pCE-K2N
Plasmid#154879PurposeEpisomally expresses KLF2 and NANOG in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCE-KdGl
Plasmid#154880PurposeEpisomally expresses KDM4D and GLIS1 in mammalian cellsDepositorAvailable SinceApril 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
PX458-sgEIF4EBP1
Plasmid#128097PurposeCRISPR gRNA against human EIF4EBP1 (4EBP1) with Cas9 from S. pyogenes and 2A-EGFPDepositorInsertCRISPR sgRNA against human 4EBP1 (EIF4EBP1 Human)
UseCRISPRExpressionMammalianPromoterhU6Available SinceSept. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLEX-EF1a ANXA11-mEmerald
Plasmid#164210PurposepLEX lentivirus backbone expresses mEmerald tagged ANXA11 under EF1a promoterDepositorAvailable SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDONR221_MFSD6
Plasmid#131953PurposeGateway entry clone with codon-optimized ORF sequence for subcloning into custom expression vectorsDepositorInsertMFSD6 (MFSD6 Human)
ExpressionMammalianAvailable SinceOct. 21, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEHC_PGKneoLox2DTA.2
Plasmid#112623PurposeH2BEmerald_p2A_HygroR_p2A_CreERt2 targeting plasmid with cloning sites ready for homology armsDepositorInsertsUseCre/Lox and Mouse TargetingTagsEmeraldPromoterNo PromoterAvailable SinceSept. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCag FlpO-2A-Cre EV
Plasmid#129419Purposeepisomal expression of FlpO and Cre recombinasesDepositorInsertFlpO-2A-Cre
UseCre/Lox and Unspecified; Episomal expression vect…ExpressionMammalianPromoterCMV/Chick β-actin (CAG)Available SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
TRE-TDP-43ΔNLS-mClover3
Plasmid#214916Purposeinducible expression of TDP-43 harboring mutant NLS and C-terminal mClover3. Expression yields cytosolic diffuse TDP-43DepositorInsertTDP-43ΔNLS (TARDBP Human)
UseLentiviralTagsmClover3Mutationmutant NLS GCAGCAGCAATGGATGAGACAGATGCTTCATCAGCAGT…Available SinceMay 17, 2024AvailabilityAcademic Institutions and Nonprofits only