We narrowed to 1,233 results for: control gRNA
-
Plasmid#250958PurposePRINCE drug inducible gene editing system based on SaCas9 (AAV-Part II : the expression of 2x ERT2 and the sgRNA is under drug-mediated control)DepositorInsertH1-TetO-SaCas9 sgRNA scaffold; EF1α-NpuC; 2×ERT2; opTtetR; GFP
UseAAV and CRISPRExpressionMammalianPromoterH1 promoter; EF1α promoterAvailable sinceJuly 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmTurquoise2
Plasmid#192828PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mTurquoise2 from hepatocyte-specific promoterDepositorInsertmTurquoise2
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-sgAAVS1-HepmCherry
Plasmid#192827PurposeExpresses sgRNA targeting AAVS1 (non-targeting control sgRNA for mouse) and mCherry from hepatocyte-specific promoterDepositorInsertmCherry
UseCRISPR and LentiviralExpressionMammalianPromoterU6 for sgRNA and hepatocyte-specific promoter (HS…Available sinceNov. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ-shNTC
Plasmid#217638PurposeDox inducible shRNA non targeting control shRNADepositorInsertshNTC
UseRNAiAvailable sinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits onlyCited by -
Phage-PGK-Flag-HA-FKBP-T(G177D)
Plasmid#181735Purposefor lentiviral expression of brachyury ORF in mammalian cellsDepositorInsertT (brachyury)
UseLentiviralMutationa silent mutation in the PAM site of an sgRNAt ta…Available sinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pBrain-GFP-shGL2
Plasmid#60004PurposeCo-expresses control GL2 shRNA and GFP.DepositorInsertEGFP
UseRNAiExpressionMammalianAvailable sinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
shNg pA_RC3J1_CAGW
Plasmid#92155PurposeBicistronic AAV construct encoding GFP control and shRNA targeting NgDepositorAvailable sinceMarch 22, 2019AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBrain-GFP-shGL2
Plasmid#60004PurposeCo-expresses control GL2 shRNA and GFP.DepositorInsertEGFP
UseRNAiExpressionMammalianAvailable sinceDec. 5, 2014AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiSAMv2 BFP-guide1
Plasmid#118165PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA1 against the BFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available sinceApril 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2 EGFP-guide3
Plasmid#118168PurposeCRISPRa negative control. Catalytically inactive Cas9 from S. pyogenes and VP64 with 2A-BlastR, and sgRNA3 against the EGFP CDSDepositorInsertdCas9-VP64-2A-BlastR
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a core and U6Available sinceMarch 29, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-GFP (PX458)
Plasmid#129026Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available sinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
TRCN0000072225
Plasmid#78160PurposeshLacZ controlDepositorInsertLacZ
UseLentiviral and RNAiPromoterhU6 and hU6Available sinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMY-CD90.2-Rluc_miR
Plasmid#163333PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the LTR promoter.DepositorAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMX-mPGK-CD90.2-Rluc_miR
Plasmid#163332PurposeRetroviral vector for negative control of knockdown expressing a non-target miR against Renilla luciferase and expression of a CD90.2 surface marker under control of the murine PGK promoter.DepositorAvailable sinceJan. 27, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC_#2-hygro
Plasmid#254677Purposeknockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
pLenti-CRISPRv2-sgNTC_#1-hygro
Plasmid#254676Purposeknockout non-targeting controlDepositorInsertsgRNA with Cas9 and hygromycin resistance
UseCRISPR and LentiviralAvailable sinceMay 4, 2026AvailabilityAcademic Institutions and Nonprofits only -
sgNS-Hygromycin
Plasmid#196198PurposecontrolDepositorInsertsgNS
UseLentiviralMutationNOAvailable sinceMarch 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCGLH-luciferase
Plasmid#194979PurposepCGLH control plasmidDepositorInsertluciferase
ExpressionBacterialAvailable sinceFeb. 28, 2023AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-KIF11
Plasmid#188685Purposecontrol sgRNADepositorAvailable sinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only