We narrowed to 15,648 results for: grn
-
Plasmid#184006PurposeExpresses arrays of gRNA targeting eve promoter under U6b/c promoterDepositorInsertU6b:sgRNAeve1 - U6c:sgRNAeve2
ExpressionInsectAvailable sinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX-APRT-sg2
Plasmid#107274PurposeAPRT sgRNA-2 and Cas9 expression vectorDepositorInsertAPRT sgRNA-2
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 mouse NT
Plasmid#242421PurposeExpression of a non-targeting shRNA in mouse cellsDepositorInsertNon-targeting shRNA
ExpressionMammalianPromoterU6Available sinceSept. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT59
Plasmid#223431PurposeT-DNA vector for dSpCas9 mediated gene activation for monocot plants; NGG PAM; dSpCas9-Act3.0 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-dSpCas9-Act3.0-OsU3-gRNA scaffold 2.0
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT37
Plasmid#223409PurposeT-DNA vector for SpRY-D10A based A-to-G base editing for dicot plants; NA or NG PAM preference; SpRYD10A-ABE was driven by AtUBQ10 and the sgRNA was driven by AtU3; Hygromycin for plants selection.DepositorInsertAtUBQ10-ecTadA8e-SpRY-D10A-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT15
Plasmid#223387PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpCas9-D10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT17
Plasmid#223389PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for monocot plants; NGG PAM; wide working window; A3A/Y130F-CBE_V01 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter.DepositorInsertZmUbi-hA3A-Y130F-SpCas9-D10A-UGI-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT21
Plasmid#223393PurposeT-DNA vector for A3A/Y130F-CBE_V01 based C-to-T base editing for dicot plants; NG or NA PAM ; wide working window; A3A/Y130F-CBE_V01 was driven by 2x35s and the sgRNA was driven by AtU3 promoter.DepositorInsert2x35s-hA3A-Y130F-SpRYD10A-UGI-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgBAX-2
Plasmid#210130Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR v2-sgBAX-1
Plasmid#210013Purposeknock out BAX in mammalian cellsDepositorInsertApoptosis regulator BAX (BAX Human)
UseCRISPRAvailable sinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PLKO.1-UPF2-CDS
Plasmid#136040PurposeUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-UPF2-3'UTR
Plasmid#136041PurposeUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)DepositorAvailable sinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pFH85
Plasmid#128198Purposeclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertclassic sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pFH86
Plasmid#128199Purposeimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)DepositorInsertimproved sgRNA backbone for SpCas9, combine with TaU3 promoter module (pFH33)
UseCRISPR and Synthetic BiologyExpressionPlantAvailable sinceAug. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
LRG/Rosa26
Plasmid#105510PurposeLentiviral expression of Rosa26 targeting sgRNADepositorInsertRosa26 (Gt(ROSA)26Sor Mouse)
UseLentiviralAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSuper-Rem2-1
Plasmid#51584PurposeshRNA 1 against rodent Rem2DepositorAvailable sinceApril 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
ZO-1 shRNA 2968
Plasmid#37208DepositorAvailable sinceAug. 27, 2012AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP X2/pTER shLUC (w454-1)
Plasmid#17491PurposeRetroviral Luciferase shRNA (H1/TO promoter), 3’LTR insertion, PuroDepositorPublicationInsertFirefly Luciferase shRNA
UseRNAi and RetroviralAvailable sinceAug. 12, 2009AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA098
Plasmid#245320PurposeCas9 CRISPRko all-in-one positive control; targets CD47DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV_AA102
Plasmid#245324PurposeCas9 CRISPRa positive control guide; targets CD47DepositorAvailable sinceOct. 2, 2025AvailabilityAcademic Institutions and Nonprofits only