We narrowed to 12,298 results for: shRNA
-
Plasmid#238249PurposeCas9 from S. pyogenes with 2A-mCherry, gRNA to knock-in msfGFP to NPM1 locusDepositorInsertNPM1
UseCRISPRAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-puro-mAnkrd11 (intron 3)
Plasmid#236608PurposeKnockouts Ankrd11 in mouse cellsDepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR2b-ITGB1(YYFF)-mRuby2
Plasmid#215447PurposeGateway entry vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseGateway entry vectorTagsmRuby2MutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoternoneAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pPB.DEST-ITGB1(YYFF)-mRuby2
Plasmid#215449PurposePiggybac expression vector with integrin beta1 NPxY mutant (YYFF) tagged with mRuby2DepositorInsertITGB1 (ITGB1 Human)
UseTransposon-based stable expressionTagsmRuby2ExpressionMammalianMutationMutations in the NPxY sites Y783F, Y795F; Silent …PromoterCAGAvailable SinceMay 29, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-mCherry-Rorb sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239029PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-Satb2 sesRNA-2a-msFlag-2a-tTA-WPRE
Plasmid#239028PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (ACOCB)
Plasmid#228115PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMCB320 sgControl (GEA)
Plasmid#228144PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (GEA)
Plasmid#228193PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGH020 sgControl (ACOCB)
Plasmid#228194PurposeSafe targeting sgRNADepositorInsertSafe targeting sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhuman U6Available SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eCas9-T2A-EGFP-U6-gRNA targeting Nrl-no ITR and f1 ori
Plasmid#234737PurposeAll-in-one CRISPR/Cas9 vector encodes high-fidelity eSpCas9 and a gRNA targeting Nrl, efficiently reprogramming rod precursors into cone-like cells in the mouse retina.DepositorAvailable SinceApril 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPOLR2D
Plasmid#229022PurposeExpression of a CRISPRi doxycycline inducible guide targeting POLR2DDepositorInsertPOLR2D gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgCh2
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgFOCAD #2
Plasmid#229024PurposeExpression of a EnAsCas12a guide targeting FOCADDepositorInsertFOCAD gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9 (BB)-2A-GFP-RB1sg
Plasmid#229857Purposesingle guide RNA targeting human RB1 geneDepositorInsertRB1sgRNA (RB1 Human)
TagsThe gamma-tubulin sgRNA is coexpressed with 3xFLA…ExpressionMammalianAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-3
Plasmid#232882PurposePlasmid expressing Cas9 and gRNA AAACCTTTTTACTCCACGCA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HIS3-2
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
KHC065 pBABE pU6 BRD2 K1-2C
Plasmid#231712PurposeKHC065 (pBABE pU6 BRD2 K1-2C), gRNA and cas9D10A mammalian expression vector for CRISPR mediated cutting of BRD2 at the N-terminus, use with KHC064DepositorAvailable SinceFeb. 19, 2025AvailabilityAcademic Institutions and Nonprofits only