We narrowed to 42,533 results for: Spr;
-
Plasmid#192686PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #2
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_ZsG gRNA_3
Plasmid#192687PurposeLentiviral expression of Cas9 and ZsGreen1 targeting sgRNADepositorInsertCas9, ZsGreen targeting sgRNA #3
UseCRISPR and LentiviralExpressionMammalianPromoterEF1a, U6Available SinceDec. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 sgZER1-1
Plasmid#191549PurposeExpression of spCas9 and sgRNA targetting ZER1DepositorInsertspCas9 (ZER1 Human)
UseLentiviralAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 sgZER1-2
Plasmid#191550PurposeExpression of spCas9 and sgRNA targetting ZER1DepositorInsertspCas9 (ZER1 Human)
UseLentiviralAvailable SinceNov. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
phABCA3-eGFP_CRISPR_Donor
Plasmid#188540PurposeHomologous recombination donor plasmid for CRISPR/Cas9 targeting of GFP fusion protein to the stop codon of endogenous human ABCA3 gene locusDepositorInsertEGFP
UseCRISPR; Donor for homologous recombinationAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+10D
Plasmid#149391PurposeP. aeruginosa PA14 CRISPR2 locus, with 10bp addition downstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation10bp inserted downstream of the IHFprox sitePromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR2_+10D+7U
Plasmid#149393PurposeP. aeruginosa PA14 CRISPR2 locus, with 10bp addition downstream,and 7bp addition upstream of IHFprox siteDepositorInsertPseudomonas aeruginosa PA14 CRISPR2 locus
ExpressionBacterialMutation7bp inserted upstream, and 10bp inserted downstre…PromoterpBADAvailable SinceAug. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2-POLB-KO-g1
Plasmid#176090PurposeCas9 plus POLB gRNA #1; contains a puromycin resistance cassetteDepositorAvailable SinceJan. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2puro-Ptgfr
Plasmid#170303PurposeA knock-out vector for the mouse PtgfrDepositorInsertA gRNA targeting the mouse Ptgfr gene.
UseCRISPR and LentiviralAvailable SinceJuly 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Nectin-2
Plasmid#170295PurposeA knock-out vector for the mouse Nectin-2DepositorInsertA gRNA targeting the mouse Nectin-2 gene.
UseCRISPR and LentiviralAvailable SinceJuly 7, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2bleo-Necl-5
Plasmid#170294PurposeA knock-out vector for the mouse Necl-5DepositorInsertA gRNA targeting the mouse Necl-5 gene.
UseCRISPR and LentiviralAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR V2 sgACO1_3
Plasmid#169893PurposeDisrupt ACO1DepositorInsertsgRNA targeting ACO1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v1-sgNADK_1
Plasmid#163462Purposelentiviral vector expressing Cas9 and an sgRNA targeting NADKDepositorInsertsgRNA 1 targeting NADK (NADK Human)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgSmg7
Plasmid#161809Purposeguide RNA for Smg7DepositorInsertsgRNA targeting mouse Smg7 (Smg7 Mouse, Synthetic)
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJan. 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-Nr4a1sgRNA2
Plasmid#160946PurposeGuide RNA 2 to generate Nr4a1 knockout by CRISPRDepositorAvailable SinceDec. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g4
Plasmid#120212PurposeCENPB CRISPRi guide RNA 4DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g3
Plasmid#120211PurposeCENPB CRISPRi guide RNA 3DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceApril 8, 2020AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-Snrnp40
Plasmid#134255PurposeLentivector for Snrnp40 CRISPR knockoutDepositorInsertSnrp40 (Snrnp40 Mouse)
UseCRISPR and LentiviralMutationSnrnp40 gRNA “GATAACTATGCGACGTTGAA”PromoterU6Available SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv1-CENPB
Plasmid#120208PurposegRNA targeting the stem loop of CENPB poly(A) siteDepositorInsertCENPB poly(A) site
UseCRISPR and LentiviralExpressionMammalianAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
CRISPRi-CENPB-g9
Plasmid#120217PurposeCENPB CRISPRi guide RNA 9DepositorInsertCENPB CRISPRi guide RNA
UseCRISPR and LentiviralAvailable SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only