We narrowed to 15,447 results for: grn
-
Plasmid#104046PurposeEncodes gRNA for 3' target of human BCL6_iso1 along with Cas9 with 2A GFPDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertBCL6_iso1 gRNA (BCL6 Human)
UseCRISPRExpressionMammalianAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits onlyCited by -
PX458_TEAD3_2
Plasmid#86338PurposeEncodes gRNA for 3' target of human TEAD3DepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against TEAD3 (TEAD3 Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_2
Plasmid#86328PurposeEncodes gRNA for 3' target of human ZGPATDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZGPAT_1
Plasmid#86327PurposeEncodes gRNA for 3' target of human ZGPATDepositorPublicationHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertgRNA against ZGPAT (ZGPAT Human)
UseCRISPRAvailable sinceJan. 27, 2017AvailabilityAcademic Institutions and Nonprofits only -
TU#1806_CRISPR_unc-73_exon21
Plasmid#82360Purposeto create unc-73E null alleleDepositorInsertCas9 and sgRNA against unc-73 exon21 (unc-73 Nematode)
UseCRISPRExpressionWormPromoterU6Available sinceSept. 14, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry-VGAT sesRNA-2a-msFlag-2a-tTA2-WPRE
Plasmid#239030PurposeExpression of mCherry, sesRNA in mammalian cells, with msFlag and tTA2 as efRNA.DepositorAvailable sinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-shJAG1 #1
Plasmid#171196PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shJAG1 #1 (to be used in conjunction with Phoenix packaging cells).DepositorAvailable sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgGAA
Plasmid#232724PurposeCas9 guide RNA targeting GAA repeats for A-to-G base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 gRNA targeting GAA repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
p2T-U6-sgCTG
Plasmid#232723PurposeSpCas9 guide RNA targeting CAG repeats for C-to-T base editingDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSpCas9 gRNA targeting CAG repeats
ExpressionMammalianAvailable sinceMarch 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgLATS1/2-1
Plasmid#229431Purposeknockout of LATS1 and LATS2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable sinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
LT3GEPIR-WT1shRNA
Plasmid#220560PurposeTo inducibly knockdown WT1 or EWSR1::WT1 expressionDepositorAvailable sinceJuly 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCLV3Cas-LT1
Plasmid#210549PurposeBinary vector expressing the Lineage Tracing system. Cas9 expression driven by CLV3 promoter. LT1 reporterDepositorInsertCLV3p::spCas9::PEA3At::U6p::AAVS1gRNA::pHTR5::LT1::mCherrySSM
ExpressionPlantMutation2bp insertion after AAVS1 target sequence that di…Available sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #1
Plasmid#198757Purposeconditional knockdown of FAKDepositorInsertshFAK #1 (PTK2 Human)
ExpressionMammalianAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #2
Plasmid#198758Purposeconditional knockdown of FAKDepositorInsertshFAK #2 (PTK2 Human)
ExpressionMammalianAvailable sinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable sinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
BoxB-MS2 adRNA (RAB7A-UAG site)
Plasmid#170138PurposeAAV vector carrying a BoxB-MS2 adRNA targeting the RAB7A transcriptDepositorInsertBoxB-RAB7A(UAG)-MS2
UseAAVExpressionMammalianPromoterHuman U6Available sinceNov. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX552-mScn2a-3xV5-EF1-smFP-flag
Plasmid#182561PurposeFor mouse Nav1.2 knockin with 3xV5 at the C-terminalDepositorInsertsmouse Scn2a gRNA and 3xV5 donor DNA
smFP-flag
UseAAV and CRISPRPromoterEF1 and U6Available sinceMarch 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pGMC00002
Plasmid#166719PurposesgRNA against human BAP1DepositorAvailable sinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
Tet-pLKO-puro shPOLE1_1
Plasmid#160810PurposeExpress Dox repressible shPOLE1DepositorInsertshPOLE1_1
UseLentiviralAvailable sinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_intergenic-intergenic_2
Plasmid#155078PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases (CHyMErA system), respectivelyDepositorInsert(hg)RNA targeting two intergenic sites in the human genome using SpCas9 and LbCas12a nucleases
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only