We narrowed to 4,533 results for: Gaa
-
-
hPLD4-sgRNA-Cas9_mcherry
Plasmid#199343Purposeencodes sgRNA for human PLD4 KO, (target Exon 5) plus Cas9-P2A-mCherryDepositorInserthSpCas9
UseCRISPRTagsP2A-mCherryExpressionMammalianMutationsgRNA: accagtagtatgaagccacgPromoterhuman U6Available SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PHGDH-int1
Plasmid#188681Purposecontrol sgRNADepositorAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
-
-
mU6-sgSik1_2nd-hU6-sgNT
Plasmid#177213PurposeExpresses a Sik1-targeting (mU6) and a non-targeting (hU6) gRNAs and Cre recombinaseDepositorInsertsgSik1_2nd/sgNT1
UseLentiviralPromotermU6/hU6Available SinceDec. 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pICSL4723_ CUL3
Plasmid#126891PurposeGenome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 module, nptII resistance gene, and specific sgRNA modules on the binary plasmid pICSL4723.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ CUL3
Plasmid#126903PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 16, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ WRKY28_2
Plasmid#126900PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTRY4_ Dja6_1
Plasmid#126894PurposeGateway pENTR-plasmid to generate a binary construct for genome editing of the wheat homolog of a susceptibility gene of O. sativa. Encodes wheat optimized Cas9 and gene specific sgRNA modules.DepositorInsertWheat_live_Cas9
UseCRISPRAvailable SinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSC37
Plasmid#104811PurposeCRISPR/Cas9 2xplex gRNA targeting Medtr3g107390 (MtRdr6). Also expresses Cas9 from Gmubi promoterDepositorInsertMedtr3g107390
UseCRISPRExpressionPlantAvailable SinceJan. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
GAPDH shRNA #1
Plasmid#32621DepositorInsertGAPDH shRNA #1
UseRNAiAvailable SinceJan. 23, 2013AvailabilityAcademic Institutions and Nonprofits only -
GAPDH shRNA #3
Plasmid#32623DepositorInsertGAPDH shRNA #3
UseRNAiAvailable SinceAug. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pYJ12-PB-U6-ND1-acti-gRNA1
Plasmid#131056PurposeActivation of NeuroD1 via SAM systemDepositorAvailable SinceOct. 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #1
Plasmid#242700PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLenti-shCHAC1 #2
Plasmid#242701PurposeshRNA knockdown human CHAC1 geneDepositorInsertCHAC1 (CHAC1 Human)
UseLentiviralAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHnS KI;Actb Donor;3xV5 KO;Dlg4
Plasmid#240292PurposeKI:Actb Donor:3xV5 KO:Dlg4DepositorInsertKI gRNA for Actb
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
-
pT7CFE1_EVA71_VP12A
Plasmid#212977PurposeEncodes EV-A71 4643 VP12A optimized for expression in mammalian transcription/translation extractsDepositorInsertEnterovirus A71 4643 VP12A
UseMammalian cell free protein expressionTagsHA tagPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_VP12A
Plasmid#212984PurposeEncodes EV-D68 MO/14/18947 VP12A optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 VP12A
UseMammalian cell free protein expressionTagsHAPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_3ABC
Plasmid#212979Purposencodes EV-D68 MO/14/18947 3ABC optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 3ABC
UseMammalian cell free protein expressionTagsHAPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1_EVD68_3ABCD
Plasmid#212981PurposeEncodes EV-D68 MO/14/18947 3ABCD optimized for expression in mammalian transcription/translation extractsDepositorInsertEV-D68 MO/14/18947 3ABCD
UseMammalian cell free protein expressionTagsHAPromoterT7Available SinceJan. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
HCP7
Plasmid#166109PurposeThis plasmid encodes a Cas9 protein as well as two sgRNAs, one targets the C-terminus of Whi5 and the other targets the C-terminus of Hta2.DepositorAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_PPE1
Plasmid#166083PurposePlasmid for constitutive spCas9 and tet-inducible PPE1 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNSU299_LYS9
Plasmid#166085PurposePlasmid for constituive spCas9 and tet-inducible LYS9 targeting sgRNA expression for double stranded break formation in yeastDepositorAvailable SinceMarch 31, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSB700-TTN-Puro
Plasmid#128323PurposeSP-dCas9 compatible gRNA to be used as a positive control for activation experiments (human cells)DepositorInsertgRNA against human TTN for activation
ExpressionMammalianAvailable SinceAug. 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_NC_chr1
Plasmid#214690PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-FLEX-SaCas9-U6-sgSlc6a3
Plasmid#159902PurposeMutagenesis of Slc6a3DepositorInsertSlc6a3 (Slc6a3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceNov. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAG1guide_RUBY_EggCas9
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRExpressionPlantPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only