We narrowed to 14,499 results for: SHR;
-
Plasmid#77567Purpose3rd generation lentiviral gRNA plasmid targeting human PAK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
PAK2 gRNA (BRDN0001148074)
Plasmid#77568Purpose3rd generation lentiviral gRNA plasmid targeting human PAK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PAK2 gRNA (BRDN0001146615)
Plasmid#77569Purpose3rd generation lentiviral gRNA plasmid targeting human PAK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001145338)
Plasmid#77699Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TP53RK gRNA (BRDN0001146963)
Plasmid#77700Purpose3rd generation lentiviral gRNA plasmid targeting human TP53RKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN1 gRNA (BRDN0001162227)
Plasmid#76276Purpose3rd generation lentiviral gRNA plasmid targeting human PKN1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PKN2 gRNA (BRDN0001147750)
Plasmid#77926Purpose3rd generation lentiviral gRNA plasmid targeting human PKN2DepositorAvailable SinceJuly 5, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p4948 pcDNA4c His Xpress SV40NLS hBrd4 CTD
Plasmid#14442DepositorInsertBrd4 CTD (BRD4 Human)
TagsSV40 NLSExpressionMammalianMutationamino acids 1047-1362 of Brd4 (the CTD). Function…Available SinceMarch 2, 2007AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgZmat3.55.9/Cre
Plasmid#167853PurposeExpresses Cre recombinase and an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3
UseCRISPR, Cre/Lox, Lentiviral, and Mouse TargetingExpressionMammalianAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001146241)
Plasmid#76467Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
NTRK2 gRNA (BRDN0001148065)
Plasmid#76468Purpose3rd generation lentiviral gRNA plasmid targeting human NTRK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMCB320-sgZmat3.51.5
Plasmid#169024PurposeExpresses an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3, mCherry, Puromycin resistance
UseCRISPR, Lentiviral, and Mouse TargetingExpressionMammalianPromotermU6Available SinceJune 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pMCB320-sgZmat3.55.9
Plasmid#169026PurposeExpresses an sgRNA targeting Zmat3DepositorInsertsgRNA targeting Zmat3, mCherry, Puromycin resistance
UseCRISPR, Lentiviral, and Mouse TargetingExpressionMammalianPromotermU6Available SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
PLK4 gRNA (BRDN0001147289)
Plasmid#76235Purpose3rd generation lentiviral gRNA plasmid targeting human PLK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
RAB11FIP5 gRNA (BRDN0001147136)
Plasmid#76186Purpose3rd generation lentiviral gRNA plasmid targeting human RAB11FIP5DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEXfrt-SaCas9-U6-sgGria3
Plasmid#124869PurposeMutagenesis of Gria3DepositorInsertGria3 (Gria3 Mouse)
UseAAV, CRISPR, and Mouse TargetingAvailable SinceMay 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN094
Plasmid#91621PurposeExpress sgRNA targeting human GRIN2ADepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
RIPK2 gRNA (BRDN0001148477)
Plasmid#76911Purpose3rd generation lentiviral gRNA plasmid targeting human RIPK2DepositorAvailable SinceJune 28, 2016AvailabilityAcademic Institutions and Nonprofits only