We narrowed to 19,308 results for: cat
-
-
A3B-Cas9n-UGI-NLS
Plasmid#198889PurposeExpress full-length A3B BE3-based base editorDepositorInsertApolipoprotein B mRNA Editing Enzyme, Catalytic Polypeptide-like 3B (APOBEC3B Human)
TagsNLSExpressionMammalianPromoterCMVAvailable SinceNov. 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDONR-SUMO1
Plasmid#114388PurposepDONR vector with SUMO1 geneDepositorInsertSUMO1 (SUMO1 Human)
ExpressionMammalianMutationQ29H compared with NCBI reference NP_003343.1Available SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
AAV-SYN-PIK3CD
Plasmid#203730PurposeAAV vector plasmid expressing human phosphoinositide 3-kinase catalytic subunit delta (PIK3CD) under the human synapsin (SYN) promoterDepositorAvailable SinceJuly 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR v2 RB1 sgRNA #2
Plasmid#202519PurposeExpressing Cas9 and sgRNA targeting human RB1 geneDepositorAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
enz.079-GCN5
Plasmid#154046PurposeExpresses GCN5 in E. coliDepositorInsertHistone acetyltransferase GCN5 (GCN5 Budding Yeast)
TagsHis, MBPExpressionBacterialPromoterT7Available SinceMay 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mPHB2-1
Plasmid#198483Purposelentiviral stable expression of mPHB2 gRNA 1DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
-
pKTop::tse5-CT (1169-1281)
Plasmid#192955PurposeFor membrane insertion study; Expresses tse5-CT (1169-1281) /PhoA (22-472)/LacZ (4-60)fusion with PelB signalpeptide fused at the N-terminusDepositorInserttse5-CT (1169-1281)
ExpressionBacterialMutationencodes for tse5 (1169-1281)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Actc1
Plasmid#99691PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Actc1 promoter, vector allows for activation of mouse Actc1, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Actc1 (gRNA sequence: GCCATTCTTGGAGCCAAGGG) (Actc1 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64Mutationdead Cas9Available SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPlacPbuCas13b-gRNA-T-MS2
Plasmid#184839PurposeExpression of a single-spacer CRISPR array with spacer #1 targeting the MS2 phage genome and expression of PbuCas13b in bacteria.DepositorInsertsingle-spacer CRISPR array with spacer #1 targeting the MS2 phage genome, PbuCas13b nuclease
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterJ23119 and lac promoterAvailable SinceOct. 5, 2022AvailabilityAcademic Institutions and Nonprofits only -
PlmdCas12e KRAB
Plasmid#188506PurposeExpresses FLAG tagged PlmdCas12e KRABDepositorInsertdCas12e
UseCRISPR and LentiviralTagsNLS-FLAG-KRAB-NLSExpressionMammalianMutationD659A/E756A/D922APromoterEF1aAvailable SinceSept. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2386-Tier1-PhCMV-GCaMP6s
Plasmid#169519PurposeTier-1 vector encoding PhCMV-driven calcium sensor GCaMP6s (PhCMV-GCaMP6s-pA).DepositorInsertPCMV-driven green fluorescent genetically encoded calcium indicator GCaMP6s
ExpressionMammalianPromoterPhCMVAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAT15416-BEAR-mScarlet-target-BFP
Plasmid#162996Purposeplasmid expressing an sgRNA targeting the BEAR-mScarlet plasmid along with a TagBFP markerDepositorInsertsgRNA targeting the BEAR-mScarlet plasmid
UseCRISPRExpressionMammalianPromoterU6Available SinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO_V5.AU1.FLAG_NGFR
Plasmid#158240PurposeProtein Barcode (Pro-Code) for vector/cell tracking. Contains U6 trRNA cassette for sgRNA cloning. Enables phenotypic CRISPR screens at a single cell resolution (using cytometry).DepositorInsertPro-Code Tagged human dNGFR (NGFR Human)
UseCRISPR and LentiviralTagsV5.AU1.FLAGMutationTruncation of the signaling domainPromoterEF1aAvailable SinceSept. 3, 2021AvailabilityAcademic Institutions and Nonprofits only -
1095=Rcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
Plasmid#159673PurposePlasmid supports Cas9 expression in both males and females, Opie2-dsRed tagged, and can be integrated with pBac or phC31.DepositorInsertRcd-1r-NLS-hSpCas9-T2A-GFP, Opie2-dsRed-SV40
TagsT2A-GFPExpressionInsectAvailable SinceMarch 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Apob-2
Plasmid#162549PurposesgRNA targeting ApobDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
px330-Apob-1
Plasmid#162548PurposesgRNA targeting ApobDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAG425 GAL Pong TPase L418A, L420A
Plasmid#145795PurposemPing Yeast Transposition AssayDepositorInsertPong TPase L418A, L420A
ExpressionYeastMutationL418A, L420AAvailable SinceJan. 20, 2021AvailabilityIndustry, Academic Institutions, and Nonprofits -
Lenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
Plasmid#157951PurposeLentiviral expression of HBG site 1 sgRNADepositorInsertLenti U6-HBG site1-EF1alpha-UGI-P2A-GFP
UseCRISPR and LentiviralExpressionMammalianAvailable SinceDec. 4, 2020AvailabilityAcademic Institutions and Nonprofits only
