We narrowed to 2,014 results for: cp
-
Plasmid#119730PurposeGABAA receptor expression (chimeric rat gamma2 short subunit whose large intracellular loop has been replaced with the large intracellular loop of the rat delta subunit) Myc-tag near N-terminusDepositorTagscMyc epitope EQKLISEEDL inserted between fourth a…ExpressionMammalianAvailable SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only
-
PKT2/CLP-Aoah
Plasmid#239612PurposeExpresses mouse Aoah protein in the transposon vectorDepositorAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TfR-SpyCatcher003(K31TAG)-sfGFP-MycTag-CTag
Plasmid#210021PurposeExpression of transferrin receptor transmembrane domain and photocaged SpyCatcher003(K31HCK)-sfGFP on mammalian cell surface.DepositorInsertTransferrin receptor transmembrane domain-SpyCatcher003(K31TAG)-superfolderGFP-MycTag-CTag (TFRC Human, Synthetic)
TagsMycTag, CTagExpressionMammalianMutationTransferrin receptor transmembrane domain with Y2…PromoterCMV promoterAvailable SinceMarch 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBS-f1(+)-ACTB-iTagRFP-T
Plasmid#115915Purposedonor to insert iTagRFP-T at the ACTB locus in human cellsDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCUU
Plasmid#159747PurposeUbiquitin promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by CFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
JDW 249 (pTol2-Dll4-F2-ETS#2-WT-8X-E1b-EGFP)
Plasmid#156417Purpose8X copies of the ETS#2 site of the murine Dll4 intronic enhancer and a minimal E1b reporter driving expression of EGFP flanked by Tol2 sitesDepositorInsertmurine Dll4 F2-6/F8 ETS site B/ site #2, 8X
UseZebrafish transgenesisPromoterE1b min pro/b-globin intronAvailable SinceAug. 19, 2020AvailabilityAcademic Institutions and Nonprofits only -
2PLU
Plasmid#60131PurposeBacterial expression for structure determination; may not be full ORFDepositorInsertcgd2_4120:MAC01Y-E08:C33348
Tags6xHisExpressionBacterialMutationSee commentsPromoterT7Available SinceOct. 22, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSems-leader-mXFPm-IFNGR1(18-489)
Plasmid#192786PurposeExpression of mXFPm-tagged IFNGR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNGR1 (IFNGR1 Human)
TagsIg k-chain leader sequence and mXFPmExpressionMammalianMutationmXFPm: tryptophan 66 to phenylalanine, gluatmic a…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-mXFPe-IFNGR2(30-337)
Plasmid#192787PurposeExpression of mXFPe-tagged IFNGR2 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNGR2 (IFNGR2 Human)
TagsIg k-chain leader sequence and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBig1a zz TEV YBBR POT1 MBP TEV TPP1 MBP TEV TIN2 ZZ TEV TRF2 (4comp2)
Plasmid#185448PurposeCoexpresses human POT1 with a zz affinity tag, YBBR site, and TEV site, human TRF2 with a zz tag and TEV site, and human TIN2 and TPP1 each with an MBP affinity tag and TEV site in insect cellsDepositorTagsMBP, YBBR, and ZZExpressionInsectMutationSee Depositor Comments BelowAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSinREP5-iAchSnFR
Plasmid#140643PurposeAcetylcholine sensor for sindbis virusDepositorArticleInsertAch sensor V9
ExpressionMammalianPromoterSP6Available SinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_wt
Plasmid#88869Purposeconstitutive expression of Ha-DDX5 in mammalian cellsDepositorAvailable SinceJune 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
Ad:2CMV_A2R2-N25Ctr
Plasmid#122243PurposeExpresses a dominant negative Kash control, that lacks the actual Kash domain for LINC complex integration, in addition to fluorescently tagged (mRuby2) α-Actinin-2 on an adenoviral backboneDepositorUseAdenoviralTagsSignal Peptide (TOR1A, NM_000113.2), mNeptune2.5,…ExpressionMammalianMutationdeleted Kash domain (GGCGAGGAGGAGCGCAGCTGCGCCCTGG…PromoterCMVAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDHa_mDDX5_FL_K144N
Plasmid#88870Purposeconstitutive expression of Ha-DDX5 K144N in mammalian cellsDepositorAvailable SinceJune 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYEE
Plasmid#159750PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by YFP fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mEGFPe-IFNAR1(28-557)
Plasmid#187844PurposeExpression of SNAPf and mEGFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and meGFPe…ExpressionMammalianMutationmeGFPe: asparagine 198 to aspartic acid and tyros…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV hSyn syph-GFP-myc-BoNT/B(1-146)-iLID
Plasmid#122981PurposeAAV plasmid with human synapsin promoter driving synaptophysin fused to GFP, iLID(V416I) and BoNT/B amino acids 1-146. Co-express with SSPB-BoNT(147-441, Y365A) for vPA-BoNTDepositorInsertSyph-GFP-myc-BoNT/B(1-146)-iLID (Syp Rat, Synthetic)
UseAAVTagsGFPExpressionMammalianPromoterhuman synapsinAvailable SinceMarch 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSems-leader-SNAPf-mXFPe-IFNAR1(28-557)
Plasmid#192785PurposeExpression of SNAPf and mXFPe-tagged IFNAR1 at the plasma membrane, e.g. for single molecule fluorescence microscopyDepositorInsertIFNAR1 (IFNAR1 Human)
TagsIg k-chain leader sequence, SNAPf-tag, and mXFPeExpressionMammalianMutationmXFPe: tyrosine 66 to phenylalanine, asparagine 1…PromoterCMVAvailable SinceDec. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTEE
Plasmid#159748PurposeEgg cell-specific promoter-controlled expression of 3×FLAG-NLS-zCas9-NLS. Contains gRNA scaffold for insertion of target sequence (U6-26 promoter). Selection of transgenic seeds by mTomato fluoresce.DepositorArticleInsertgRNA scaffold
UseCRISPRExpressionPlantAvailable SinceOct. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
TMEM216-mCherry
Plasmid#41633DepositorAvailable SinceApril 24, 2013AvailabilityAcademic Institutions and Nonprofits only