We narrowed to 9,373 results for: Pol;
-
Plasmid#114618PurposeBacterial expression of Htt fragment containing amino acids 2-90, with A2C & A60C cysteine mutations and a 37 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C, A60C; 37 polyQ repeatAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt2-90(A2C)-15Q-A60C
Plasmid#114608PurposeBacterial expression of Htt fragment containing amino acids 2-90, with A2C & A60C cysteine mutations and a 15 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C, A60C; 15 polyQ repeatAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt2-90(A2C)-23Q
Plasmid#114612PurposeBacterial expression of Htt fragment containing amino acids 2-90, with A2C cysteine mutation and a 23 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationA2C; 23 polyQ repeatAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
DH10beta F' DOT sbcC (donor strain)
Bacterial Strain#12082DepositorBacterial ResistanceTetracyclineAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pET21b(+)-Is-PETase-W159H-S238F
Plasmid#112203PurposepET-21b(+) based plasmid for expression of PETase from Ideonella sakaiensis 201-F6 (Genbank GAP38373.1) with W159H and S238F mutations, codon optimized for expression in E. coli K12DepositorInsertPETase gene from Ideonella sakaiensis 201-F6 with W159H and S238F mutations, codon optimized for expression in E. coli K12
Tags6XHISExpressionBacterialMutationW159H, S238FPromoterN/AAvailable SinceJuly 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-Hygro-EF1A-EGFP-PARP1
Plasmid#176146PurposeEGFP fused to the N-terminus of PARP1 & a hygromycin resistance cassetteDepositorInsertPoly(ADP-Ribose) Polymerase 1 (PARP1 Human)
UseLentiviralTagsEGFPExpressionMammalianPromoterEF1AAvailable SinceJan. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV uN2C GFP (Ctl)
Plasmid#224355PurposeExpress GFP tagged upsteram ORF of NOTCH2NLC with a control size (12x) of GGC repeatsDepositorInsertuN2C
UseAAVTagseGFPExpressionMammalianMutationCodon-optimized for expression in human, so no pu…PromoterCMV + chimeric intyron (CAG)Available SinceOct. 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pEN487 - Sororin-AID[71-114]-eGFP-FRT-Blast-FRT targeting conuct
Plasmid#156433PurposeTargeting vector to introduce an AID-eGFP cassette at the mouse Cdca5 (SORORIN) locus using BLASTICIDIN selection. Auxin-inducible degron system. Designed to be used with sgRNA GGGATGCCCGTCATTAAGTGDepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-42Q-P90C
Plasmid#114606PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceOct. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P80C
Plasmid#114602PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P80C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceOct. 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-A60C
Plasmid#114601PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-42Q-P70C
Plasmid#114605PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P70C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-42Q-A60C
Plasmid#114604PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & A60C cysteine mutations and a 42 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, A…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pTWIN1-His6-Ssp-Htt18-90(Q18C)-22Q-P90C
Plasmid#114603PurposeBacterial expression of Htt fragment containing amino acids 18-90, with Q18C & P90C cysteine mutations and a 22 polyQ repeatDepositorInsertHuntingtin Exon1 fragment (HTT Human)
TagsHis6-Ssp DnaB inteinExpressionBacterialMutationdNt17 (deletion of first 17 amino acids), Q18C, P…Available SinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pHIS-MDH1-HIS
Plasmid#184558PurposeBacterial expression of human MDH1 with HIS TagDepositorAvailable SinceJune 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAU002 - pTRE3G-CTCF(DELTA1-265)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156429PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationDELTA1-265Available SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEN515 - pTRE3G-CTCF(ZFmut)-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156434PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA (all Zinc fingers point mutated), targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationAll zinc fingers mutatedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAU003 - pTRE3G-Cterm_Nterm_switch_CTCF-mRuby2-CAGGS-rtta3G-Frt-PGK-PuroR-bpA-Frt TIGRE
Plasmid#156430PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible mutant CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorInsertCTCF, rtta3G, TetO3G (Ctcf Mouse)
UseMouse TargetingExpressionMammalianMutationCterm_Nterm_switchedAvailable SinceSept. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
BUN21/pML300 (recipient strain)
Bacterial Strain#11675DepositorBacterial ResistanceSpectinomycinSpeciesBacteriophage lambdaAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pEN366 - pTRE3G-CTCF-mRuby2-BGHpA-CAGGS-rtta3G-rbgpA-Frt-PGK-EM7-PuroR-bpA-Frt TIGRE donor
Plasmid#156432PurposeVector to introduce a constitutive rtta3G cassette and a DOX-inducible wild-type CTCF mouse cDNA, targeting the mouse TIGRE acceptor locus. Use with Addgene #92144 sgRNA. Use puromycine selection.DepositorAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
MSCV-N BKV ER
Plasmid#37864DepositorUseRetroviralTagsFlag and HAExpressionMammalianPromoterPKGAvailable SinceJuly 24, 2012AvailabilityAcademic Institutions and Nonprofits only -
pCAS
Plasmid#60847PurposeExpresses S. pyogenes Cas9 plus an HDV ribozyme-sgRNA for genome editing in yeastDepositorInsertsS. pyogenese Cas9
RNA pol III promoter (tRNA-Tyr)
hepatitis delta virus ribozyme, genomic
sgRNA
UseCRISPR and Synthetic BiologyTagsNLS/His8 and TTT 3' extension prior to sgRNAExpressionBacterial and YeastMutationL4 is UUCG tetraloop and guide targets LYP1 (CATA…Available SinceJan. 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-mCherry-P2A-T2A-nanobody-KS
Plasmid#238287PurposeFor integration of mCherry-P2A-T2A-nanobody-KSDepositorInsertmCherry-P2A-T2A-nanobody-KS
ExpressionMammalianAvailable SinceSept. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
Seattle_IPDA_control_1_001
Plasmid#167347PurposeddPCR gating control for droplets containing all 5 targets (2 in pol)DepositorInsertpol_gag_tat_env
UseOtherAvailable SinceApril 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA5-F-ELL2
Plasmid#49422PurposeMammalian expression of flag-tagged human ELL2DepositorAvailable SinceDec. 5, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGLS
Plasmid#110319PurposeshGLS (Target CAACTGGCCAAATTCAGTC), silence human GLS gene and express monomeric Kusabira-Orange2DepositorInsertGLS Glutaminase (GLS Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(N77)
Plasmid#246056PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before N77) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-N77
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
H1_sgRNA(GRIN2B)_SauCas9_AcrIIA5-AsLOV2(D41)
Plasmid#246055PurposeExpression of a sgRNA targeting the GRIN2B locus, a SauCas9 and an AcrIIA5-cpGR2 hybrid (insertion before D41) linked through a P2A sequence, under the same pol-III H1 promoterDepositorInsertSauCas9, sgRNA(GRIN2B) and AcrIIA5_AsLOV2-D41
UseCRISPR and Synthetic BiologyExpressionMammalianAvailable SinceDec. 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
TRE3G-mCherry-P2A-T2A-nanobody-KS-FtoA
Plasmid#238288PurposeFor integration of mCherry-P2A-T2A-nanobody-KS-FtoADepositorInsertmCherry-P2A-T2A-nanobody-KS-FtoA
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only