We narrowed to 16,291 results for: grna
-
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
AAV-shRNA-ctrl
Plasmid#85741PurposeshRNA ctrlDepositorInsertshRNA ctrl
UseAAVTagsEYFPAvailable SinceApril 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCRISPRia-v2
Plasmid#84832PurposeCRISPRi/a V2 library parental plasmidDepositorInsertssgRNA
puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available SinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pUC CBA-SpCas9.EF1a-BFP.sgLMNA
Plasmid#98971PurposeCas9 Homologous Recombination Reporter. SpCas9 and a sgRNA targeting LMNA. TagBFP.DepositorInsertLMNA sgRNA and spCas9
ExpressionMammalianAvailable SinceDec. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pC0043-PspCas13b crRNA backbone
Plasmid#103854PurposeFor cloning of guide RNAs compatible with PspCas13b. Contains a 3' direct repeat. Clone using BbsI (BpiI). F overhang cacc. R overhang caacDepositorHas ServiceCloning Grade DNAInsertU6-BbsI-BbsI-PspCas13b DR-polyT
UseCRISPRExpressionMammalianAvailable SinceNov. 28, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTRIPZ shNS
Plasmid#127696PurposeDoxycyclin inducible pTRIPZ lentivirus vector containing a non-silencing sequence for both human and mouseDepositorInsertshNS
UseLentiviralExpressionMammalianAvailable SinceNov. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9n(BB)-2A-GFP (PX461)
Plasmid#48140PurposeCas9n (D10A nickase mutant) from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorInserthSpCas9n
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationCas9 D10A nickase mutantPromoterCbhAvailable SinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
pICH41331::pU6cm-pegR::EURb7
Plasmid#227695PurposeGolden Gate level 0 acceptor vector for cloning altered epegRNA: altered epegRNA being driven by U6 composite promoter (pU6cm) and terminated by a dual terminator (EURb7).DepositorInsertAltered epegRNA backbone with cloning sites for gRNA and RTT.
UseCRISPRExpressionPlantPromoterU6 compositeAvailable SinceNov. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
pHSG1C3
Plasmid#164423Purposesingle guide RNA (sgRNA) and Prime editing guide RNA (pegRNA) cloning and mammalian cell expression. BbsI cloning for sgRNAs and BbsI/PstI for pegRNAs.DepositorInsertsgRNA
UseCRISPR and Synthetic BiologyExpressionMammalianPromoterU6Available SinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDIV270
Plasmid#226181PurposeExpresses Cas9 and gRNA targeting KU70 gene in K. phaffii.DepositorInserttRNA-sgRNA-tRNA
UseCRISPRExpressionBacterial and YeastPromoterTEF1p (Komagataella phaffii)Available SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
AWP-029
Plasmid#213966PurposeExpresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for gRNA constitutive expression.DepositorInsertCas12a (cas12a Synthetic, Segatella bryantii)
Tags3XFLAGExpressionBacterialMutationD875A to inactivate target nuclease activityPromoterPcfxA, IPTG inducibleAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-G3BP1-3'UTR
Plasmid#136038PurposeG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330-mcherry
Plasmid#98750PurposeCas9 from S.pyogenes with CMV-mcherry cassette, and cloning backbone for sgRNADepositorTypeEmpty backboneUseCRISPRExpressionMammalianPromoterU6Available SinceOct. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pYPQ132B2.0
Plasmid#99888PurposeGolden Gate entry vector to express the 2nd gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYPQ131B2.0
Plasmid#99885PurposeGolden Gate entry vector to express the 1st gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU3 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU3Available SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
LRG2.1
Plasmid#108098PurposeLentiviral expression plasmid of sgRNA with GFPDepositorTypeEmpty backboneUseCRISPR and LentiviralExpressionMammalianPromoterU6 promoter for sgRNA expression and EFS promoter…Available SinceJune 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBSU6-shTim23/CMV-eGFP
Plasmid#89795PurposeExpresses shRNA against TIM23 with a separate promoter for expression of GFP.DepositorInsertshRNA Tim23 (Timm23 Mouse)
TagseGFP under separate promoterExpressionMammalianPromoterU6Available SinceMay 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
pnCasPA-BEC
Plasmid#113349PurposeA cytidine deaminase-mediated base-editing plasmid in Pseudomonas speciesDepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyAvailable SinceAug. 3, 2018AvailabilityAcademic Institutions and Nonprofits only -
All_in_one_CRISPR/Cas9_LacZ
Plasmid#74293Purpose"All-in-one" CRISPR/Cas9 (wt) plasmid for cloning of custom gRNA with blue/white screeningDepositorInsertsLacZ-alpha
Cas9
mCherry
UseCRISPRTagsHAExpressionBacterial and MammalianPromoterLac promoter, SV40, and T7 promoterAvailable SinceMay 11, 2016AvailabilityAcademic Institutions and Nonprofits only