We narrowed to 25,345 results for: Spr
-
Plasmid#207751PurposeDonor template for Blast-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Blast-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCC_04 - hU6-BsmBI-sgRNA(E+F)-barcode-EFS-xCas9NG-NLS-2A-Puro-WPRE
Plasmid#139089PurposeExpresses human codon-optimized xCas9-NG nuclease in mammalian cells. For cloning of sgRNAs using BsmBI. Contains a unique barcode downstream of sgRNA cassette.DepositorInsertxCas9-NG
UseCRISPR and LentiviralExpressionMammalianMutationA262T,R324L, S409I, E480K, E543D, M694I, L1111R, …Available SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_ATP1A1_G2_Dual_sgRNA
Plasmid#86612PurposeVector for tandem expression of ATP1A1 G2 sgRNA in combination with a user-specified sgRNA from two independent U6 promoters. Cloning of oligos for second sgRNA using BbsI sites. Px333-like plasmidDepositorInsertATP1A1 G2 sgRNA + user-specified sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPR; Co-selection via nhej using ouabainExpressionMammalianMutationK848A, K1003A, & R1060APromoterCBhAvailable SinceMarch 16, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-mNeon-ACTB
Plasmid#207752PurposeDonor template for Puro-2A-mNeon insertion into the N-terminus of the ACTB locus for actin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-ACTB Addgene #207748DepositorInsertACTB Homology Arms flanking a Puro-mNeon Cassette (ACTB Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCas9_sgRNA_0
Plasmid#70763Purposeexpresses Ustilago maydis codon-optimized Cas9, contains U. maydis U6 promoter, is self-replicatingDepositorInsertsU6 promoter
cas9
tnos terminator
UseSelf-replicating in ustilago maydis, conferring c…TagsN-terminal NLS, C-terminal HA-tag +NLSMutationStreptococcus pyogenes gene codon-optimized for U…PromoterU6 from Ustilago maydis and synthetic otef promot…Available SinceNov. 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pVD1 Multiplexing Edit E3-E4-En-1 (GB2244)
Plasmid#160566PurposeGBoligomers for the position [3_(n-1)] of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoter.DepositorInsertMultiplexing Edit (E3-E4-En-1)
UseCRISPR and Synthetic BiologyMutationBsaI and BsmBI sites removedAvailable SinceMarch 24, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAGT9569
Plasmid#219431PurposeTranscriptional unit (MoClo-position 2): pAtRPS5a_PapE-4LF2-N-SpCas9i-N_tNOSDepositorInsertLB_AtRPS5a:PapE-4xLF2-NLS-SpCas9i-NLS:tNOS_RB (Position 2)
UseCRISPR and Synthetic Biology; Moclo compatible le…TagsPapE-4LF2ExpressionPlantAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRM049 His-TEV-Cas9 triNLS 2C
Plasmid#196245PurposeExpression of NLS-rich Cas9 (2 Cys residues, mammalian codon optimized)DepositorInsertCas9
UseCRISPRTagsHA, His6 (N terminal on backbone), NLS, Nucleopla…ExpressionBacterialAvailable SinceAug. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mNeon-Puro-TOMM20
Plasmid#207790PurposeDonor template for mNeon-2A-Puro insertion into the C-terminus of the TOMM20 locus. For mitochondria visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TOMM20 (Addgene #207789)DepositorInsertTOMM20 Homology Arms flanking a mNeon-Puro Cassette (TOMM20 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJEP317-pAAV-U6SaCas9gRNA(SapI)-EFS-GFP- KASH-pA
Plasmid#113694PurposeU6 driven SaCas9 gRNA expression cassette without a gRNA. Followed by an EFS driven GFP-KASH in a separate reading frame. SapI can be used to clone in gRNAs.DepositorInsertsSaCas9 gRNA Cassete
GFP
UseAAV and CRISPRTagsKASHAvailable SinceJan. 2, 2019AvailabilityAcademic Institutions and Nonprofits only -
pHR-UCOE-SFFV-dCas9-XTEN80-KRAB(Kox1)-P2A-EGFP
Plasmid#188765PurposedCas9 with a C-term HA-2xNLS-XTEN80(linker)-KRAB(Kox1)DepositorInsertdCas9-XTEN80-KRAB(Kox1)
UseLentiviralTagsHA-2xNLS-XTEN80(linker)-KRAB(Kox1)PromoterSFFVAvailable SinceOct. 20, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-Luciferase-hvTK-bla
Plasmid#179450PurposeDonor vector to knock in firefly Luciferase C-terminal to human PER2 geneDepositorInsertLuciferase
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
H516 SONIC KrasG12D-IRES-luciferase donor
Plasmid#138178PurposeCRISPR SONIC: Kras G12D luciferase donor plasmid.DepositorInsertKrasG12D (Kras Mouse)
UseNhej donorAvailable SinceMarch 20, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA1
Plasmid#138187Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
KAT5 sgRNA2
Plasmid#138188Purpose3rd generation lentiviral gRNA plasmid targeting human KAT5DepositorAvailable SinceMarch 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ100 AAV-SpABE8e-C_terminus-tracrRNA
Plasmid#211818PurposeAAV vector expressing C-terminus of SpCas9-ABE8e with tracrRNADepositorInsertC-terminus of SpCas9-ABE8e and tracrRNA
UseAAVExpressionMammalianPromoterchicken β-actin promoter and U6 promoterAvailable SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDB-hPER2-mClover3-CD4-bla
Plasmid#179448PurposeDonor vector to knock in mClover3 N-terminal to human PER2 geneDepositorInsertmClover3
UseCRISPRTagsHis/FlagPromoterNoneAvailable SinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-mStayGold-Puro-CLTC
Plasmid#227314PurposeDonor template for mStayGold-2A-Puro insertion into the C-terminus of the CLTC locus. For clathrin heavy chain visualization. To be co-transfected with sgRNA px330-PITCh-CLTC (Addgene #227312)DepositorInsertCLTC Homology Arms flanking a mStayGold-2A-Puro Cassette (CLTC Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only