We narrowed to 11,471 results for: AGA
-
Plasmid#99307PurposeLuciferase validation vector with IGF1R enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr15: 99439352 -99440791
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
STARR-seq luciferase validation vector_SCP1_IGF1R
Plasmid#99308PurposeLuciferase validation vector with IGF1R enhancer inserted downstream of the reporter gene. The candidate's enhancer activity is reflected by luciferase activityDepositorInsertenhancer; chr15: 99439352 -99440791
UseLuciferase; Starr-seq luciferase validation vectorExpressionMammalianAvailable SinceSept. 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
pSIREN-RetroQ-HSPE-sh2
Plasmid#92034PurposepSIREN-RetroQ vector containing shRNA sequence to HPSEDepositorInsertshRNA #2 to HPSE (Hpse Mouse)
UseRetroviralAvailable SinceJuly 19, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
p426_Cas9_gRNA-SAP155c
Plasmid#87390PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting SAP155c sequence ATGAAAGACAACTATAGGGC in yeast chromosome 6DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting SAP155c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
TTBK2 gRNA (BRDN0001148497)
Plasmid#77971Purpose3rd generation lentiviral gRNA plasmid targeting human TTBK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PHKA2 gRNA (BRDN0001146948)
Plasmid#77844Purpose3rd generation lentiviral gRNA plasmid targeting human PHKA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
POMK gRNA (BRDN0001144851)
Plasmid#77761Purpose3rd generation lentiviral gRNA plasmid targeting human POMKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB1 gRNA (BRDN0001147285)
Plasmid#77630Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PFKFB1 gRNA (BRDN0001162492)
Plasmid#77632Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
TAOK2 gRNA (BRDN0001148565)
Plasmid#77249Purpose3rd generation lentiviral gRNA plasmid targeting human TAOK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only