We narrowed to 18,604 results for: She
-
Plasmid#238919PurposeMammalian expression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in excitatory neuronsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCaMKIIalfaAvailable SinceAug. 19, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CMV-RFP-p2A-DAAO(R285A)-NES
Plasmid#238921PurposeExpression of mutated DAAO(R285A) with a nuclear export signal and RFP as a reporter in mammalian cellsDepositorInsertRFP-p2A-DAAO(R285A)-NES
UseAAVExpressionMammalianPromoterCMVAvailable SinceAug. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-ZNF84
Plasmid#226450PurposeFor subcloning of human ZNF84 promoter or for assays using M13 phageDepositorAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
TOPO-CHR12:132.68MB LG4
Plasmid#226454PurposeEncodes an LG4 enhancer for subcloning or for assays using M13 phageDepositorInsertCHR12:132.68MB LG4
UseCloning vectorMutationNoAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pSUMO1-del
Plasmid#228950Purposeexpress the full-length human SAE1:SAE2 heterodimer ( where SAE1 is untagged and SAE2 contains an N-terminal tag : MGSSHHHHHHSQDADLNSRVD, derivated from the Addgene plasmid #52258 pSUMO1)DepositorTagsHis tag and thrombine cleavage site : MGSSHHHHHHS…ExpressionBacterialPromoterRBS and T7-lacAvailable SinceMay 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-NET1
Plasmid#232893PurposePlasmid expressing Cas9 and gRNA GTGCCACTAATGGATCCATG which targets the NET1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA355_sgCiPOLR2D
Plasmid#229022PurposeExpression of a CRISPRi doxycycline inducible guide targeting POLR2DDepositorInsertPOLR2D gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgCh2
Plasmid#229023PurposeExpression of a EnAsCas12a control guide that cuts an intergenic region on chromosome 2DepositorInsertsgChr2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDA052H_sgFOCAD #2
Plasmid#229024PurposeExpression of a EnAsCas12a guide targeting FOCADDepositorInsertFOCAD gRNA
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pXPR_051d_sgCiChr2-2
Plasmid#228940PurposeExpression of a CRISPRi control sgRNA that cuts an intergenic region on chromosome 2DepositorInsertsgChr2-2
UseCRISPR and LentiviralExpressionMammalianAvailable SinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-HRAS(GV12)
Plasmid#233181PurposeRetroviral expression of HRAS(G12V)DepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-Isl1-P2A-mRuby2
Plasmid#233169PurposeRetroviral expression of Isl1 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mLhx3-P2A-mRuby2
Plasmid#233175PurposeRetroviral expression of mLhx3 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-mNgn2x3HA-P2A-mRuby2
Plasmid#233157PurposeRetroviral expression of Ngn2x3HA with mRuby2 fluorescent reporterDepositorInsertmNgn2x3HA-P2A-mRuby2 (Neurog2 Mouse, Synthetic)
UseRetroviralTagsx3HAExpressionMammalianAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-Isl1-P2A-mRuby2
Plasmid#233158PurposeRetroviral expression of Isl1 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR-mLhx3-P2A-mRuby2
Plasmid#233159PurposeRetroviral expression of mLhx3 with mRuby2 fluorescent reporterDepositorAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMXs-mNgn2x3HA-P2A-mRuby2
Plasmid#233163PurposeRetroviral expression of Ngn2x3HA with mRuby2 fluorescent reporterDepositorInsertmNgn2x3HA-P2A-mRuby2 (Neurog2 Mouse, Synthetic)
UseRetroviralTagsx3HAExpressionMammalianAvailable SinceMarch 13, 2025AvailabilityAcademic Institutions and Nonprofits only