We narrowed to 14,283 results for: cas9
-
Plasmid#242653PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with nVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-SpCas9-VRQR-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, VRQR mutations in SpCas…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABE8.8m-eVRQR-P2A-EGFP (BKS974)
Plasmid#242655PurposeCMV promoter expression plasmid for human codon optimized ABE8.8m A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABE8.8m-VRQR(S55R)-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE8.8 mutations in TadA, eVRQR mutations in SpCa…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ABEmax-eVRQR-P2A-EGFP (LLH575)
Plasmid#242654PurposeCMV promoter expression plasmid for human codon optimized ABEmax(7.10) A-to-G base editor with neVRQR(D10A) and P2A-EGFPDepositorInsertpCMV-ABEmax-VRQR-S55R-P2A-EGFP
UseCRISPRTagsBPNLS and BPNLS-3xFLAG-P2A-EGFPExpressionMammalianMutationABE7.10 mutations in TadA, eVRQR mutations in SpC…PromoterCMV and T7Available SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRDB_161
Plasmid#216091PurposeCas9 [Sp] CRISPRi targeting CD81, positive controlDepositorInsertCD81 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_834
Plasmid#216087PurposeCas9 [Sp] knockout targeting CD59, positive controlDepositorInsertCD59 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDB_156
Plasmid#216090PurposeCas9 [Sp] CRISPRa targeting CD274, positive controlDepositorInsertCD274 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRDA_833
Plasmid#216086PurposeCas9 [Sp] knockout targeting CD47, positive controlDepositorInsertCD47 guide
UseCRISPR and Lentiviral; Positive controlsAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-UPP1_sgRNA2
Plasmid#201635PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertUPP1 (UPP1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-ALDOA_sgRNA1
Plasmid#201590PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertALDOA (ALDOA Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO-Cre sgAmotl2 v3
Plasmid#158602Purposelenti-viral construct with Cas9, Cre recombinbase and U6 driven sgRNA against mouse Amotl2DepositorInsertAmotl2 sgRNA
ExpressionMammalianPromoterU6Available SinceSept. 30, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
pDGE671
Plasmid#153237PurposeRecipient plant transformation vector containing selection markers and a Cas9 expression cassette, but lacking guide RNAsDepositorTypeEmpty backboneUseCRISPRTagsGFPExpressionPlantAvailable SinceSept. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
Lenti-SLC35B2-sgRNA
Plasmid#154860PurposeLentiviral expression of Cas9 and sgRNA targeting SLC35B2DepositorAvailable SinceJuly 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
Mouse CRISPRa sgRNA library Caprano in backbone XPR_502 (P65 HSF), Set B
Pooled Library#92384PurposeCRISPRaDepositorExpressionMammalianUseCRISPR and LentiviralAvailable SinceJuly 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
REV7 C-terminal sgRNA
Plasmid#207095PurposepX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.DepositorInsertGCTCATAAAGGCAGCTGAGG
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 N-terminal sgRNA
Plasmid#207094PurposepX330 based plasmid for expression of Cas9 and the TTACTGCAGAATGACTACAG sgRNA to target the SHLD3 locus.DepositorInsertTTACTGCAGAATGACTACAG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
RNF169 C-terminal sgRNA
Plasmid#207099PurposepX330 based plasmid for expression of Cas9 and the ACACTTCATTAGGTGCTACT sgRNA to target the RNF169 locus.DepositorInsertACACTTCATTAGGTGCTACT
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD1 N-terminal sgRNA
Plasmid#207101PurposepX330 based plasmid for expression of Cas9 and the ATGGCAGGACTATGGCAGCC sgRNA to target the SHLD1 locus.DepositorInsertATGGCAGGACTATGGCAGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM C-terminal sgRNA
Plasmid#207097PurposepX330 based plasmid for expression of Cas9 and the TTTCTAAAGGCTGAATGAAA sgRNA to target the ATM locus.DepositorInsertTTTCTAAAGGCTGAATGAAA
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
SHLD3 KO sgRNA #1
Plasmid#207105PurposepX330 based plasmid for expression of Cas9 and the CGCTATCAAGATTTATACCT sgRNA to target the SHLD3 locus..DepositorInsertCGCTATCAAGATTTATACCT
ExpressionMammalianPromoterCMV and U6Available SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATG13 sgRNA
Plasmid#207558PurposepX330 expressing Cas9 and a sgRNA targeting the ATG13 locusDepositorInsertggaaactgatctcaattccc
ExpressionMammalianPromoterCMV and U6Available SinceApril 22, 2024AvailabilityAcademic Institutions and Nonprofits only