We narrowed to 14,321 results for: cas9
-
Plasmid#202822PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and mcherry expressionDepositorInserttwo sgRNAs that delete exon 1 within the ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-ZNF91-BFP
Plasmid#202823PurposeLentiviral vector modified to express two sgRNAs that delete exon 1 within the ZNF91 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete exon 1 within ZNF91 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralExpressionMammalianPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
Chr8q_Centromere-Targeting_gRNA
Plasmid#195128PurposegRNA targeting centromere-proximal location on Chromosome 8q in a third generation Cas9 backbone with GFPDepositorInsertChr8q gRNA
ExpressionMammalianAvailable sinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pWZ194
Plasmid#163640Purposerps-27>DHB::2xmKate2-P2A-H2B::GFP expression plasmid for CRISPR/Cas9 integration at ttTi4348 site on chromosome IDepositorInsertDHB::2mKate2-P2A-H2B::GFP::3xHA (his-58 Synthetic, Nematode)
UseCRISPRTags2xmKate2 and GFPExpressionWormPromoterrps-27Available sinceMarch 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pDEST-APIC-H840A
Plasmid#250797PurposeDrosophila transgenic vector: Gateway cloning destination vector for expressing enhancer driven Cas9-derived nickase H840A.DepositorPublicationTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceApril 15, 2026AvailabilityAcademic Institutions and Nonprofits only -
pDEST-APIC-D10A
Plasmid#250796PurposeDrosophila transgenic vector: Gateway cloning destination vector for expressing enhancer driven Cas9-derived nickase D10A.DepositorPublicationTypeEmpty backboneUseCRISPRExpressionInsectAvailable sinceFeb. 18, 2026AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable sinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTopo RE2 Donor pLox hPGK-Puro pA pLox
Plasmid#171049PurposeDonor template for CRISPR/Cas9 targeting of TERT RE2DepositorInsertPuromycin
UseCre/LoxExpressionMammalianAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTopo RE3 Donor pLox hPGK-Puro pA pLox
Plasmid#171050PurposeDonor template for CRISPR/Cas9 targeting of TERT RE3DepositorInsertPuromycin
UseCre/LoxExpressionMammalianAvailable sinceAug. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRVV700
Plasmid#119017PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available sinceMarch 15, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV609
Plasmid#119014PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available sinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV688
Plasmid#119015PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available sinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
pRVV689
Plasmid#119016PurposeDonor vector for creation of TP901-1 attP-flanked platforms for cassette exchange using CRISPR/Cas9DepositorInsertTP901-1 attP sites
UseCRISPR; Donor vector for creation of platforms fo…Available sinceFeb. 1, 2019AvailabilityAcademic Institutions and Nonprofits only -
C119
Plasmid#174354PurposeCRISPR-Cas9 with guide targeting human PABPC1 genomic location near STOP codonDepositorInsertgRNA sequence targeting human PABPC1 near stop codon region
UseCRISPRAvailabilityAcademic Institutions and Nonprofits only -
pInt-ERCreER
Plasmid#190040PurposeThis is an integration donor plasmid to insert a DNA fragment for doxycycline inducible ERT2-Cre-ERT2 at the AAVS1 locus. It works with an AAVS1 targeting CRISPR/Cas9 construct (Addgene #72833).DepositorInsertERT2-Cre-ERT2 flanked by AAVS1
UseCRISPR and TALENExpressionMammalianAvailable sinceJan. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSECC-sgLKB1-A
Plasmid#138663PurposeExpresses a mouse LKB1-targeting sgRNA, Cas9, and Cre-recombinaseDepositorAvailable sinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGTag Hygro EGFP cLAP +2
Plasmid#194310PurposeCRISPR/Cas9-mediated generic protein taggingDepositorInsertcLap(EGFP)-P2A-Hygro
UseBacterial cloning vectorAvailable sinceFeb. 7, 2023AvailabilityAcademic Institutions and Nonprofits only