We narrowed to 28,641 results for: Tat
-
Plasmid#236073PurposeSleeping Beauty transposon plasmid for hydrodynamic tail vein injection (HDTVi) into mice. Pgk promotor driven expression of mVenus and mutant NRAS (NRASG12V).DepositorInsertsUseSleeping beauty transposon plasmidMutationG12VPromoterPGKAvailable SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pTK41
Plasmid#236110PurposeExpresses the motor domain of rat KIF5C fused with SNAP tag and ALFA tag nanobodyDepositorInsertsTagsALFA tag nanobody, His tag, SNAP tag, and StrepII…ExpressionBacterialMutationC7S mutation is introduced. 1-430 aa is encoded.PromoterT7Available SinceMay 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
18065-M04-412
Plasmid#225667PurposeLentivirus protein expression. Control plasmid.DepositorInsertsUseLentiviralTags3xFLAGMutationC-terminally truncated (aa 1-333 only)PromoterWPRE-SV40p and mCMVpAvailable SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
sgMST1/2-1
Plasmid#229429Purposeknockout of MST1 and MST2DepositorUseCRISPR and LentiviralExpressionMammalianPromoterhU6;bU6;EFSAvailable SinceDec. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCR8/GW_TOPO_Cdk13_Untagged
Plasmid#127342PurposeUntagged mouse Cdk13 transgene (NP_001074527.1 isoform) cloned into Gateway entry vectorDepositorInsertCyclin Dependent Kinase 13 (Cdk13 Mouse)
UseEntry vector with transgene for gateway cloningMutationBase pairs 1-1554 of transgene are codon optimize…PromoterNoneAvailable SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTRE3G-human cGASdeltaN R255E-HA
Plasmid#186894PurposeDoxycycline-dependent expression of human cGAS gene (with R255E mutation) in mammalian cells by retroviral transductionDepositorInsertHuman cGAS truncation mutant (160-522 a.a.) with R255E mutation and C-terminal HA tag (Adamts1 Human, Synthetic)
UseRetroviralTagsHAMutationN-terminal truncation, R255EPromoterTRE3GAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
macroH2A2-V192F-GFP (pc5116)
Plasmid#223439PurposeMutation of valine 192 to phenylalanine (V192F) in macroH2A2.DepositorTagsGFPExpressionMammalianMutationMutation of valine 192 to phenylalanine (V192F)PromoterCMVAvailable SinceOct. 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-GFP-LA
Plasmid#206197PurposeExpresses GFP-tagged human Lamin-A protein by the constitutive CMV promoter in miceDepositorAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1
Plasmid#169831PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids F1366 - P1376; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop2
Plasmid#169832PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletion of amino acids R1398 - S1407; TCCC ->…Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Loop1 and Loop2
Plasmid#169833PurposeExpresses C-terminal flag-tagged CAD with deletion of amino acids R1398 - S1407 and F1366 - P1376 in allosteric domainDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationDeletions of amino acids R1398 - S1407 and F1366 …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMXS-IRES-BLAST flag-CAD delta Allosteric Domain
Plasmid#169835PurposeExpresses C-terminal flag-tagged CAD with substitution of allosteric domain F1308 - C1455 with a (GGGS)X3 linkerDepositorInsertCAD (CAD Human)
UseRetroviralTagsFlag tagExpressionMammalianMutationSubstitution of amino acids F1308 - C1455 with a …Available SinceJuly 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSCBE3-NG-HF1-Hypa
Plasmid#218162PurposeThis plasmid harbors the base editor SCBE3-NG-HF1-Hypa along with an sgRNA cloning cassette, facilitating high-fidelity cytosine base editing at targets bearing NG PAM in Streptomyces.DepositorInsertsscbe3-NG-HF1-Hypa
a programmable sgRNA cloning cassette
UseCRISPR; Sgrna transcriptionExpressionBacterialMutationMutations in the portion of SpCas9 : D10A / N497A…PromoterrpsL promoterAvailable SinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-N1303K-ngRNA+14_EF1a-puroR
Plasmid#207359PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of N1303K-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertN1303K-CFTR +14 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
Lenti-L227R-ngRNA+15_EF1a-puroR
Plasmid#207360PurposeLentiviral transfer plasmid encoding hU6-driven expression of a ngRNA for correction of L227R-CFTR via prime editing and EF1a-driven puromycin resistance gene.DepositorInsertL227R-CFTR +15 ngRNA
UseLentiviralAvailable SinceApril 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(CXCR4-E2(38))-PGKpuro2ABFP-W
Plasmid#200481PurposeLentiviral vector expressing gRNA targeting human CXCR4-E2DepositorInsertCXCR4-E2(38) (CXCR4 Human)
UseLentiviralAvailable SinceApril 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-R272Q
Plasmid#214911Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationR272Q substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
CILK1-E80K
Plasmid#214910Purposeexpression of the mutant variant of CILK1DepositorInsertCILK1 (CILK1 Human)
TagsMyc-FLAGExpressionMammalianMutationE80K substitutionPromoterCMVAvailable SinceMarch 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V1-rCD20-BSD
Plasmid#209752PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 1) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only