We narrowed to 12,237 results for: LEA
-
Plasmid#210834PurposemTALEAD expression vectorDepositorInsertFor specific A-to-G base editing to introduce targeted A-to-G mutation in 16S rRNA in chloroplast
ExpressionPlantAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
mTALEAD 16S rRNA-1
Plasmid#210833PurposemTALEAD expression vectorDepositorInsertFor specific A-to-G base editing to introduce targeted A-to-G mutation in 16S rRNA in chloroplast
ExpressionPlantAvailable sinceSept. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET22b-FXa-cleavableELP
Plasmid#219403PurposeFactor Xa-responsive elastin-like polypeptide (ELP)DepositorInsertFXa-cleavableELP
Tags6xHisExpressionBacterialAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
p21-mCerulean-PuroR
Plasmid#215077PurposeExpresses p21-mCerulean in mammalian cells from a retroviral vector.DepositorAvailable sinceApril 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCK005 ubi:mCerulean_ubb-polyA
Plasmid#195979PurposeExpression constructDepositorInsertubi:mCerulean
UseOtherAvailable sinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
mCerulean3-Bik-s2193
Plasmid#177425PurposeTo express mCerulean3 fused to the N-terminus of the Bcl-2 family protein, Bik, in a plasmid with Blasticidin resistance. Used to make stable BMK-DKO cell lines.DepositorInsertBik, Bcl-2-interacting killer, or Apoptosis inducer NBK (BIK Human)
TagsmCerulean3ExpressionMammalianPromoterHuman ferritinAvailable sinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
TRE3GV-somBiPOLES-mCerulean
Plasmid#192578PurposeAAV-vector for bidirectional optogenetic manipulation of tetTag-positive neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianPromoterTRE3GVAvailable sinceDec. 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-SspB (pBS1075)
Plasmid#185299PurposeMammalian expression of sleeping chironomid protein PvLEA4_repeats_k3_26 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formation.DepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable sinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_shuffle_3_mCh-2xFKBP (pBS1119)
Plasmid#185314PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_shuffle_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_shuffle_3
ExpressionMammalianAvailable sinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
LEA1_APHAV_Chakrabortee pSecTag (pBS0254)
Plasmid#185143PurposeFor the mammalian expression of the nematode (Aphelenchus avenae) protein LEA1_APHAV. This is one of the bottom performing targets in our apoptosis assay (it induced apoptosis).DepositorInsertLEA1_APHAV
ExpressionMammalianAvailable sinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-2xFKBP (pBS1123)
Plasmid#185318PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-2xFKBP (pBS1122)
Plasmid#185317PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-2xFKBP (pBS1121)
Plasmid#185316PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertpvLEA22mer_mutant_10
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k3_26_mCh-2xFKBP (pBS1118)
Plasmid#185313PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k3_26 attached to 2xFKBP. The FKBP can be used for inducible dimerization and condensate formationDepositorInsertPvLEA4_repeats_k3_26
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-mCerulean-tDeg
Plasmid#185401PurposemCerulean-tDeg fluorogenic proteinDepositorInsertmCerulean-tDeg
ExpressionMammalianMutationWTPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_3_mCh-SspB (pBS1080)
Plasmid#185303PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_3 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_3
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
PvLEA4_repeats_k5_1_mCh-SspB (pBS1079)
Plasmid#185302PurposeFor the mammalian expression of the sleeping chironomid protein PvLEA4_repeats_k5_1 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertPvLEA4_repeats_k5_1
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pvLEA22mer_mutant_10_mCh-SspB (pBS1078)
Plasmid#185301PurposeFor the mammalian expression of the sleeping chironomid protein pvLEA22mer_mutant_10 attached to SspB for light inducible binding to iLID scaffolds. Systems like this can be used to induce condensate formationDepositorInsertpvLEA22mer_mutant_10
ExpressionMammalianAvailable sinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
Scarlet I-FRET 10-Cerulean3
Plasmid#139374PurposeFRET StandardDepositorInsertCerulean3 N1
ExpressionMammalianAvailable sinceApril 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-Cerulean
Plasmid#127771PurposeEnhancer reporter construct containing the chicken EdnrB enhancer, E2 driving Cerulean activityDepositorInsertednrbE2
UseEnhancer reporter constructAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only