We narrowed to 16,743 results for: grna
-
Plasmid#187599PurposeBase editing plasmid, constitutively expressing cytosine base editor and cas6. Contains GFP, flanked by BsaI restriction sites to introduce spacer and gRNAs. Apramycin resistanceDepositorInsertnCas9-BEC-UGI; cas6f, gfp
ExpressionBacterialPromotertrcAvailable SinceJuly 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEN_TmiR_Luc-A
Plasmid#25760PurposeEntry vector withTRE promoter driving control Luciferase miR30-based shRNA.DepositorInsertLuciferase miR-shRNA
UseGateway CloningAvailable SinceJuly 1, 2010AvailabilityAcademic Institutions and Nonprofits only -
Circular 100,50 (RAB7A)
Plasmid#170117PurposeAAV vector carrying a guide RNA targeting the human RAB7A mRNADepositorInsertCircular 100,50 guide RNA
UseAAVExpressionMammalianPromoterHuman U6Available SinceFeb. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Dicer2
Plasmid#14764DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
GWF297
Plasmid#133612PurposeTET3G-2xMS2(wt+f6), NLS-MCP-ANR-ANR-P2a-BFPDepositorInsertTET3G-2xMS2(wt+f6), MCP-ANR-ANR, BFP
ExpressionMammalianAvailable SinceOct. 30, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSUPER IKKalpha
Plasmid#26208DepositorInsertpSUPER IKK alpha (CHUK Human)
UseRNAiAvailable SinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pSicoR human Drosha2
Plasmid#14767DepositorAvailable SinceApril 5, 2007AvailabilityAcademic Institutions and Nonprofits only -
AAV-phsyn-FLEX-KASH-EGFP-U6-ShGmeb1
Plasmid#129706PurposeExpress cre-dependent KASH-EGFP and Gmeb1 shRNADepositorInsertKASH-EGFP
UseAAVTagsEGFPExpressionMammalianPromoterU6Available SinceAug. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSuper mouse DGCR8-1
Plasmid#14772DepositorAvailable SinceApril 6, 2007AvailabilityAcademic Institutions and Nonprofits only -
pSUPERIORpuro-shGAS5
Plasmid#46370DepositorAvailable SinceAug. 16, 2013AvailabilityAcademic Institutions and Nonprofits only -
Intron-Tagging-pX330-Cas9-mCherry
Plasmid#159742PurposeExpresses Cas9-2A-mCherry and a sgRNA excising EGFP flanked by a splice acceptor and a splice donor from the Intron-Tagging-EGFP-Donor plasmid.DepositorInsertdonor plasmid targeting sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceNov. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_PARP1
Plasmid#183312PurposeAll-in-One CRISPRko system with a guide RNA that targets PARP1 geneDepositorInsertPARP1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3A
Plasmid#183283PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3A geneDepositorInsertDNMT3A
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_DNMT3B
Plasmid#183284PurposeAll-in-One CRISPRko system with a guide RNA that targets DNMT3B geneDepositorInsertDNMT3B
UseLentiviralAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-CAPRIN1-3'UTR
Plasmid#136055PurposeCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)DepositorAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
shNTC
Plasmid#73549PurposeNon-targeting control shRNA cloned in retroviral vector pMLP (MSCV-based vector expressing shRNA in a mir30 context).DepositorInsertshNTC
UseRetroviralExpressionMammalianPromoterLTRAvailable SinceAug. 8, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAPM-D4 miR30-MORC2 ts1
Plasmid#115886PurposeMORC2 knockdownDepositorAvailable SinceJan. 10, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPRIME-CMV-Neo-FF3
Plasmid#11665Purpose3rd generation lentiviral transfer vector. pPRIME cloning plasmid with a CMV promoter controlling expression of Neomycin and miR30-based shRNA targeting firefly luciferaseDepositorInsertFF3
UseLentiviralTagsNeoExpressionMammalianAvailable SinceMarch 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pFIV-H1-Puro-hPolß
Plasmid#18663DepositorInsertshRNA specific to human DNA polymerase beta (POLB Human)
UseLentiviral and RNAiExpressionMammalianMutationnoneAvailable SinceOct. 24, 2008AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_IDH1
Plasmid#183300PurposeAll-in-One CRISPRko system with a guide RNA that targets IDH1 geneDepositorInsertIDH1
UseLentiviralAvailable SinceMay 25, 2022AvailabilityAcademic Institutions and Nonprofits only