We narrowed to 16,121 results for: grna
-
Plasmid#187276PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin delta Actin binding domainDepositorInsertAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra) (ANLN Human)
UseLentiviralTagsmCherryMutationdeltaActin binding domainPromoterU6, CMVAvailable sinceSept. 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT005
Plasmid#182715PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT006
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available sinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPv2_AAVS1
Plasmid#184487PurposeLentivirus all in one CRISPR vector targeting human AAVS1 geneDepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable sinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgDHODH-2
Plasmid#186023Purposeknock out DHODH in mammalian cellsDepositorAvailable sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
lentiCRISPR v2-sgACSL4
Plasmid#186024Purposeknock out ACSL4 in mammalian cellsDepositorInsertAcyl-CoA Synthetase Long Chain Family Member 4 (ACSL4 Human)
UseCRISPR and LentiviralPromoterU6Available sinceJune 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
CROP_C9_Puro_ERBB2
Plasmid#183287PurposeAll-in-One CRISPRko system with a guide RNA that targets ERBB2 geneDepositorPublicationInsertERBB2
UseLentiviralAvailable sinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET1.2-U3
Plasmid#173156PurposeSingle guide RNA cassette under U3 promoterDepositorInsertsgRNA cassette under U3 promoter
ExpressionPlantPromoterpromoter region of the U3C snRNA gene (Marshallsa…Available sinceJune 3, 2022AvailabilityAcademic Institutions and Nonprofits onlyCited by -
petRNA-FANCF-v3'
Plasmid#181803PurposepetRNA FANCF v3'DepositorInsertribozyme-petRNA
UseCRISPRAvailable sinceApril 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV2-mtIF3 shRNA_TagRFP657
Plasmid#182367PurposeshRNA targeting mtIF3 mRNADepositorAvailable sinceMarch 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)_No_FLAG_LMNA_G2
Plasmid#178090PurposeExpresses the LMNA G2 sgRNA in combination with FLAGless eSpCas9(1.1). This vector can be used in combination with LMNA_mScarlet-I_Donor to tag LMNA with mScarlet-I. pX330-like plasmid.DepositorInsertLMNA G2 sgRNA + FLAGless enhanced specificity Cas9 (1.1)
UseCRISPRExpressionMammalianPromoterU6 promoterAvailable sinceDec. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pU6nH1-HD10kb
Plasmid#172657PurposeExpressing paired pegRNAs from human U6 and H1 promoters to make 10204-bp deletion on HPRT1 geneDepositorInsertpegRNA-HD10kbA/pegRNA-HD10kbB
UseCRISPRAvailable sinceOct. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAT15415-BEAR-GFP-target-mCherry
Plasmid#162995Purposeplasmid expressing an sgRNA targeting the BEAR-GFP plasmid along with an mCherry markerDepositorInsertsgRNA targeting the BEAR-GFP plasmid
UseCRISPRExpressionMammalianPromoterU6Available sinceSept. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pKHH030_sgCtrl#1
Plasmid#174142PurposeLentiviral vector expressing a control sgRNA that targets a safe harbor siteDepositorInsertControl sgRNA
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2_AMBRA1#1
Plasmid#174152PurposeLentiviral vector expressing Cas9 and a sgRNA against the human AMBRA1 geneDepositorAvailable sinceSept. 10, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pMCB619
Plasmid#171011PurposeCRISPR sgRNA vector (puro-BFP with BstXI/BlpI digest sites).DepositorInsertU6:sgRNA_Puro-T2A-BFP
UseCRISPR and LentiviralExpressionMammalianPromotermU6Available sinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pSuper-gmiR-124
Plasmid#171555Purposea human miR-124-expressing plasmidDepositorInsertmiR-124 (MIR124-1 Human)
ExpressionMammalianAvailable sinceAug. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
GluA3 (px330:2-guideCas9)
Plasmid#169424PurposeExpression of Cas9 and 2 guidesDepositorInsertspCas9
UseCRISPRExpressionMammalianAvailable sinceJune 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-KLF7-1
Plasmid#169797PurposeExpresses Cas9 and guide RNA for the site neighbouring KLF7 gene.DepositorInsertguide RNA for KLF7 neighbouring region
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceJune 11, 2021AvailabilityAcademic Institutions and Nonprofits only -
CSAC-Bmal1
Plasmid#168296PurposeExpresses sgRNA in mammalian cellsDepositorInserthU6-sgBmal1-1-hU6-sgBmal1-3
UseAAVTagsmCherryPromoterU6, hSynAvailable sinceMay 12, 2021AvailabilityAcademic Institutions and Nonprofits only