We narrowed to 5,551 results for: crispr cas9 grna plasmid

#87398

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1206a sequence CGAACATTTTTCCATGCGCT in yeast chromosome 12.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87385

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#163712

Yeast high copy plasmid with dCas9, sgRNA expression cassette and VPR activation domains

Yvonne Nygård

Camara et al Sci Rep. 2020 Sep 3;10(1):14605. doi: 10

Nov. 1, 2021

Academic Institutions and Nonprofits only

#163709

Yeast low copy plasmid with dCas9, sgRNA expression cassette and VPR activation domains

Yvonne Nygård

Camara et al Sci Rep. 2020 Sep 3;10(1):14605. doi: 10

Nov. 1, 2021

Academic Institutions and Nonprofits only

#124844

Vector for Cre-dependent expression of SaCas9

Larry Zweifel

Hunker et al Cell Rep. 2020 Mar 24;30(12):4303-4316.e

May 6, 2019

Academic Institutions and Nonprofits only

#107055

Backbone vector for cloning in target sgRNA for use with SaCas9 (SauCas9)

Alex Hewitt

April 18, 2018

Academic Institutions and Nonprofits only

#79145

All-in-one CRISPR/Cas9 vector with high-fidelity eSpCas9 expression in human pluripotent stem cells

Jizhong Zou

June 24, 2016

Academic Institutions and Nonprofits only

#163708

Yeast low copy plasmid with dCas9, sgRNA expression cassette and Mxi1 transcriptional repressor

Yvonne Nygård

Camara et al Sci Rep. 2020 Sep 3;10(1):14605. doi: 10

Nov. 1, 2021

Academic Institutions and Nonprofits only

#87405

p426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87409

p426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only