We narrowed to 962 results for: GGCT;
-
Plasmid#77987Purpose3rd generation lentiviral gRNA plasmid targeting human EXOSC10DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
MB 45t3 thsS(t3)R-sfGFP_mCherry
Plasmid#232470PurposeOptimized thiosulfate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
ExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPR-B_2xsgRNAs_RPP21 (pAVA3259)
Plasmid#239327PurposeLentiviral vector expressing Cas9-P2A-Blasticidin and two sgRNAs targeting RPP21DepositorInsertU6-driven sgRNA1 and 7SK-driven sgRNA2 targeting RPP21 (RPP21 Human)
UseCRISPR and LentiviralAvailable SinceAug. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_2-As
Plasmid#218814PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLCHKOv3-mClover-intergenic_4-As
Plasmid#218816PurposeLentiviral vector expressing mClover3 along with U6 driven hybrid guide (hgRNA) targeting two intergenic sites in the human genome using SpCas9 and AsCas12a nucleases (CHyMErA system), respectivelyDepositorInsertintergenic hgRNA with SpCas9 tracrRNAv1 & AsCas12a DR
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceJune 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
MB 94C thsS(t3)R-Bxb1_P7-sfGFP_mCherry
Plasmid#232471PurposeOptimized thiosulfate sensor with recombinase switch and fluorescent reporter (GFP), constitutive mCherryDepositorInsertsthsS(t3)
thsR
PphsA342
sfGFP
AxeTxe
mCherry
Bxb1 integrase
TagsssrA degradation tagExpressionBacterialMutationContains the following mutations K286Q, Q350H, I…PromoterJ23100 (TTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGC), J23…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCF806-shABC2
Plasmid#186714PurposeExpresses dox-controlled miR-E shRNAs (UT4GEPIR). Multi-miR shRNAs targeting A-RAF, B-RAF, and C-RAF (shABC2 = shARAF.169-shBRAF.1296-shCRAF.387). The shABC2 set is better than shABC1.DepositorAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-(BB)-hPGK-KRAB-dCas9-P2A-BlastR PHF21A-TSS-guide1
Plasmid#125432PurposeCRISPR-mediated repression of PHF21A. KRAB domain and Catalytically inactive Cas9 from S. pyogenes with 2A-BlastR under the hPGK promoter.DepositorInsertKRAB-dCas9-2A-BlastR
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhPGK and U6Available SinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode7
Plasmid#229069PurposeExpression mappingDepositorInsertCAG Barcode7
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode6
Plasmid#229068PurposeExpression mappingDepositorInsertCAG Barcode6
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV CAG Barcode2
Plasmid#229063PurposeExpression mappingDepositorInsertCAG Barcode2
UseAAVAvailable SinceDec. 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode15
Plasmid#226189PurposeExpression mappingDepositorInsertSyn Barcode15
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode13
Plasmid#226187PurposeExpression mappingDepositorInsertSyn Barcode13
UseAAVAvailable SinceOct. 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV Syn Barcode22
Plasmid#226193PurposeExpression mappingDepositorInsertSyn Barcode22
UseAAVAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV 3xgRNA KO;Rbfox3
Plasmid#240311PurposeKO:NeuNDepositorInsertKO gRNAs for NeuN
UseAAVMutationNAAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
ZMAT4.1.2-gDNA
Plasmid#175872PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZMAT4-Nickase2
UseCRISPRAvailable SinceOct. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
pZNF668.1.0-gDNA
Plasmid#132463PurposeCRISPR/Cas9 plasmid to create GFP fusion proteinsDepositorInsertZNF668 (ZNF668 Human)
UseCRISPRAvailable SinceDec. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
AiP942-pX330-Sncg
Plasmid#181774PurposeCRISPR/Cas9 guide vectorDepositorInsertSncg guide
UseCRISPRExpressionMammalianAvailable SinceMarch 14, 2022AvailabilityAcademic Institutions and Nonprofits only