We narrowed to 6,747 results for: SIM
-
Plasmid#29702DepositorInsertEFEMP1 (EFEMP1 Human)
UseTagsV5ExpressionMammalianMutationlacks N-terminus of EFEMP1 (amino acids 1-105)PromoterAvailable sinceAug. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myriRFP670V5-P2A-post-eGRASP
Plasmid#111585PurposeAn AAV vector that expresses double floxed myristoylated iRFP670 with V5 tag and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyriRFP670V5-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EWB-DIO-myrTagRFP-T-P2A-post-eGRASP
Plasmid#111581PurposeAn AAV vector that expresses double floxed myristoylated TagRFP-T and post-eGRASP linked by self-cleaving P2A peptide under the Ef1a promoter.DepositorInsertmyrTagRFP-T-P2A-post-eGRASP
UseAAVTagsExpressionMutationPromoterEf1aAvailable sinceJune 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBabepuro-KIBRA
Plasmid#40887DepositorInsertKIBRA (WWC1 Human)
UseRetroviralTagsExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV9)
Viral Prep#154951-AAV9PurposeReady-to-use AAV9 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV5)
Viral Prep#154948-AAV5PurposeReady-to-use AAV5 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV5)
Viral Prep#154951-AAV5PurposeReady-to-use AAV5 particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV9)
Viral Prep#154948-AAV9PurposeReady-to-use AAV9 particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag4/hL3MBTL1
Plasmid#28231DepositorInsertl(3)mbt-like 1 (Drosophila) (L3MBTL1 Human)
UseTagsFLAGExpressionMammalianMutationIrrelevant S49T mutationPromoterAvailable sinceFeb. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV-Tag4/hL3MBTL2
Plasmid#28232DepositorInsertl(3)mbt-like 2 (Drosophila) (L3MBTL2 Human)
UseTagsFLAGExpressionMammalianMutationPromoterAvailable sinceJune 22, 2011AvailabilityAcademic Institutions and Nonprofits only -
pASK/3xMBT
Plasmid#28234DepositorInsertl(3)mbt-like 1 (Drosophila) (L3MBTL1 Human)
UseTagsHisExpressionBacterialMutationTruncation expressing only aa 252-606 (MBT repeat…PromoterAvailable sinceMay 23, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shKIBRA-A
Plasmid#40888DepositorInsertshKIBRA-A (WWC1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceMarch 7, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1puro-shKIBRA-B
Plasmid#40889DepositorInsertshKIBRA-B (WWC1 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceNov. 5, 2012AvailabilityAcademic Institutions and Nonprofits only -
USPQ-HTT-TALEN1
Plasmid#92243PurposeTALEN targeting upstream of HTT gene (KKR), forms obligate heterodimer with USPQ-HTT-TALEN2DepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCMVAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
USPQ-HTT-TALEN2
Plasmid#92244PurposeTALEN targeting upstream of HTT gene (ELD), forms obligate heterodimer with USPQ-HTT-TALEN1DepositorInsertTALEN
UseTALENTagsExpressionMutationPromoterCMVAvailable sinceFeb. 26, 2019AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
CaMKII-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154948-AAVrgPurposeReady-to-use AAV Retrograde particles produced from CaMKII-somBiPOLES-mCerulean (#154948). In addition to the viral particles, you will also receive purified CaMKII-somBiPOLES-mCerulean plasmid DNA. CamKII-driven expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIIa(0.4)TagsmCeruleanAvailable sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-DIO-somBiPOLES-mCerulean (AAV Retrograde)
Viral Prep#154951-AAVrgPurposeReady-to-use AAV Retrograde particles produced from hSyn-DIO-somBiPOLES-mCerulean (#154951). In addition to the viral particles, you will also receive purified hSyn-DIO-somBiPOLES-mCerulean plasmid DNA. Synapsin-driven, Cre-dependent expression of soma-targeted BiPOLES for optogenetic inhibition (blue light) and activation (red light). These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCerulean (Cre-dependent)Available sinceSept. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
hSyn-somBiPOLES-mCerulean
Plasmid#154945PurposeOptogenetic tool for blue-light inhibition and red-light excitation of neuronsDepositorInsertsomBiPOLES
UseAAVTagssoma-targeting motif from Kv2.1 channelExpressionMammalianMutationPromoterhuman synapsinAvailable sinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only