We narrowed to 106 results for: crispr cas9 vector px330

#100898

SpCas9 with a cloning backbone for 2 custom gRNAs which can be cloned in via a one-step reaction. For generation of double knock-outs and large deletions in a single plasmid system.

Paul Thomas

Adikusuma et al PLoS One. 2017 Dec 6;12(12):e0187236. do

Dec. 14, 2017

Academic Institutions and Nonprofits only

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#107273

eGFP sgRNA-1 and Cas9 expression vector (aka. pX-ps1)

Knut Woltjen

Kim et al Nat Commun. 2018 Mar 5;9(1):939. doi: 10

March 15, 2018

Academic Institutions and Nonprofits only

#107274

APRT sgRNA-2 and Cas9 expression vector

Knut Woltjen

Kim et al Nat Commun. 2018 Mar 5;9(1):939. doi: 10

March 15, 2018

Academic Institutions and Nonprofits only

#197869

CRISPR/Cas9/sgRNA plasmid for cutting Med6 C terminal and building MED6-mEmerald/Halo knock-in mESCs

Zhe J. Liu

Dong et al bioRxiv 2022.10.26.513917

March 3, 2023

Academic Institutions and Nonprofits only

#197870

CRISPR/Cas9/sgRNA plasmid for cutting Med1 N terminal and building mEmerald/Halo-MED1 knock-in mESCs

Zhe J. Liu

Dong et al bioRxiv 2022.10.26.513917

March 3, 2023

Academic Institutions and Nonprofits only