We narrowed to 18,191 results for: puro
-
Plasmid#192003PurposeLentiviral vector to generate LYSET(TMEM251)-isoform1 R45W mutant stable expressing cell line under CMVTRE3G promoterDepositorAvailable SinceOct. 31, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pTS2333_Tier3(Lenti_inverse)-YPet_Puro
Plasmid#169664PurposeTier-3 vector for stable integration via lentiviral transduction in inverted direction with polyA carrying a constitutive expression cassette for puromyine and Ypet (PCMV-5'LTR-Psi-gag-env-PRPBSA-YPet-p2A-PuroR-pA::A2-pA::A3-pA-WPRE-3'LTR)DepositorInsertPRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPhCMV / RPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2361_Tier3(SB)-rtTA-YPet_PuroR
Plasmid#169657PurposeTier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS2363_Tier3(PB)-rtTA-YPet_PuroR
Plasmid#169659PurposeTier-3 vector for stable stable integration of up to three cassettes via Piggy Bac transposase including a YPet marker and PuroR resistance gene and a PPGK-driven rtTA transactivator (5'ITR-A1-pA::PPGK-rtTA-pA::PRPBSA-YPet-p2A-PuroR-pA-3'ITR)DepositorInsertPPGK-driven rtTA expression and PRPBSA-driven YPet and PuroR expression
ExpressionMammalianPromoterPRPBSAAvailable SinceJune 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hCASP8
Plasmid#185378PurposeFor mammalian expression of guide RNA: AAGCAATCTGTCCTTCCTGA that targets human CASP8 (Caspase 8)DepositorAvailable SinceJune 8, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hARAF-1
Plasmid#185367PurposeFor mammalian expression of guide RNA: caccgTGGTCTACCGACTCATCAAG that targets human ARAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-1
Plasmid#185365PurposeFor mammalian expression of guide RNA: caccgACAACAGTTATTGGAATCTC that targets human BRAFDepositorAvailable SinceJune 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pX459-puro-hBRAF-2
Plasmid#185366PurposeFor mammalian expression of guide RNA: caccgAAAATCCCACAGATGTGGCA that targets human BRAFDepositorAvailable SinceJune 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-puro-dHbegf
Plasmid#173841PurposeA knockout vector for the dog Hbegf.DepositorInsertA gRNA targeting the dog Hbegf gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
LentiCRISPRv2-puro-dEgfr
Plasmid#173844PurposeA knockout vector for the dog Egfr.DepositorInsertA gRNA targeting the dog Egfr gene and the cDNA of CRISPR-Cas9
UseCRISPR and LentiviralAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisEgf
Plasmid#173845PurposeEncoding dog Egf.DepositorInsertA cDNA of canis EGF.
ExpressionMammalianMutationR1127Q- please see dep. commentsAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisHbegf
Plasmid#173846PurposeEncoding dog Hbegf.DepositorInsertA cDNA of canis Hbegf.
ExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisTgfa
Plasmid#173847PurposeEncoding dog Tgfa.DepositorInsertA cDNA of canis Tgfa.
ExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pPBpuro-UbC-canisEreg
Plasmid#173848PurposeEncoding dog Ereg.DepositorInsertA cDNA of canis Tgfa.
ExpressionMammalianAvailable SinceOct. 21, 2021AvailabilityAcademic Institutions and Nonprofits only -
pIVTR(T7G)-PuroR
Plasmid#172290PurposeIn vitro transcription of Puro resistance gene (pac)DepositorInsertPuroR
UseOtherPromoterT7 promoter G-initiatingAvailable SinceAug. 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pmx-puro-Mef2c-i
Plasmid#172398PurposeRetroviral expression vector for murine direct cardiac reprogrammingDepositorInsertMef2c-i (Mef2c Mouse)
UseRetroviralAvailable SinceJuly 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.S295L.RFP.P2A.PURO.JL.p163
Plasmid#170174PurposeLentiviral Expression of EF1a.SLC6A1.S295L.RFPDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
MS2592.EF1a.SLC6A1.A288V.P2A.PURO.JL.p166
Plasmid#170171PurposeLentiviral Expression of EF1a.SLC6A1.A288VDepositorAvailable SinceJune 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7V51G-VA
Plasmid#115183PurposeLentiviral transduction and expression of PARK7V51G into any mammalian cellDepositorInsertPARK7V51G (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.V51GPromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLD-puro-Cc-PARK7C53A-VA
Plasmid#115184PurposeLentiviral transduction and expression of PARK7C53A into any mammalian cellDepositorInsertPARK7C53A (PARK7 Human)
UseLentiviralTagsVersatile affinity tag (2XStreptactin II-6XHis-3X…Mutationp.C53APromoterCMVAvailable SinceMarch 26, 2021AvailabilityAcademic Institutions and Nonprofits only